J. Lipid Res. Neurobiology of Lipids (ISSN1683-5506)
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li-Stiles, B.
Right arrow Articles by Fischer, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li-Stiles, B.
Right arrow Articles by Fischer, S. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Journal of Lipid Research, Vol. 39, 569-582, March 1998
Copyright © 1998 by Lipid Research, Inc.

Article

Identification and characterization of several forms of phospholipase A2 in mouse epidermal keratinocytes

Bangyan Li-Stilesa, Herng-Hsiang Loa, and Susan M. Fischera
a The University of Texas M.D. Anderson Cancer Center, Science Park, Research Division, P.O. Box 389, Smithville, TX 78957

Correspondence to: Susan M. Fischer.


  ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES

The tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA) stimulated the release of arachidonic acid (AA) from mouse keratinocytes. A distinct difference was observed between the fatty acid release profile elicited by TPA and other stimuli. These findings led to the investigation of keratinocyte phospholipase A2 (PLA2), which catalyzes the release of sn-2 fatty acids from membrane phospholipids and regulates the production of eicosanoids. We characterized and identified several forms of PLA2 in mouse keratinocytes, a cytosolic or cPLA2 and two secretory or sPLA2s in the membrane. The PLA2 in keratinocyte cytosol is sensitive to heating and acid treatment, while resistant to reducing reagent. The PLA2 in keratinocyte membrane is resistant to heating and acid treatment, while sensitive to reducing reagent. These characteristics suggested the presence of a cPLA 2 and at least one type of sPLA2. Inhibitor data further confirmed the identities of these PLA2s. The cPLA2 was activated by TPA, and appeared to be responsible for the majority of the specific release of AA observed in mouse keratinocytes treated with TPA. The calcium ionophore A23187, and 4{alpha}-TPA did not elicit the selectivity towards AA observed with TPA. The release of linoleic acid (LA) and oleic acid (OA) from A23187- and 4{alpha}-TPA-treated keratinocytes suggests activation of sPLA2. These activities may be due to the existence of both type I and type II sPLA2, as both were identified by polymerase chain reactions.

In conclusion, keratinocytes express several forms of phospholipase A 2 that differ in their substrate specificities and mechanisms of activation, resulting in distinct agonist-specific fatty acid release profiles.—Li-Stiles, B., H-H. Lo, and S. M. Fischer. Identification and characterization of several forms of phospholipase A 2 in mouse epidermal keratinocytes. J. Lipid Res. 1998. 39: 569–582.

Supplementary key words: arachidonic acid, cPLA2, keratinocytes, PLA2, sPLA2, TPA


  INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
METHODS
 RESULTS
 DISCUSSION
 REFERENCES

Many of the responses of skin to normal or pathological agents are mediated by one or more of the eicosanoids or their precursors. Diverse types of damage to the skin, e.g., ultraviolet irradiation, physical wounding, and chemical irritants including tumor promoters and xenobiotic agents, induce the release of one or more free fatty acids, particularly arachidonic acid (AA) (1) (2) (3). Released AA is readily metabolized and these metabolites are involved in such defense mechanisms as inflammation, immune processes, tissue repair, and induced epidermal hyperplasia (4) (5). Other fatty acids can also be hydrolyzed and metabolized, but often have different biological activities than AA-derived eicosanoids. For example, the 13-hydroxyoctadecadienoic acid (13-HODE) metabolite of linoleic acid (LA) in some cases has opposing activities to the 12-hydroxyeicosatetraenoic acid (12(S)-HETE) metabolite of AA (6) (7). As the predominant mechanism for the release of fatty acids from the sn-2 position of glycerophospholipids is hydrolysis by the phospholipase A2 (PLA2, E. C. 3.1.1.4) enzymes, activation of different forms of PLA2s may result in the release of different fatty acids and qualitatively or quantitatively alter eicosanoid production and subsequent biological responses.

Several families of PLA2 have been identified in mammalian tissues: the low-molecular mass (14 kD) types I and II PLA2, referred to as secretory or sPLA2, and the high-molecular mass (85 kD) cytosolic PLA2 (cPLA2) (8) (9). The sPLA2s differ from the cPLA2 in several significant ways. sPLA2s are located either in the membrane or extracellularly and have been reported to have a broad range of substrate preferences, with regard to phospholipid and sn-2 fatty acids (8). cPLA2, on the other hand, is localized primarily in the cytosol unless it is activated. cPLA2 also shows a substrate preference towards sn-2 AA esterified to phosphatidylcholine. It has been suggested that cell-associated sPLA2 functions primarily in maintaining cell membrane homeostasis, extracellular sPLA2 in inflammatory diseases, while cPLA2 may be involved in the initiation of the inflammatory response. Both sPLA2 and cPLA2 may be differentially regulated to modify the lipid composition of mouse skin during differentiation of epidermal basal cells which move upwards to become corneocytes (10) (11). These changes in lipid composition in the epidermis, especially in the stratum corneum, have been suggested to play important roles in skin barrier function (12) (13) (14).

Several other forms of PLA2 have also been reported. For example, platelets contain a PLA2 that has recently been identified as the 29 kD zeta-isoform of the 14-3-3 protein (15). A 56 kD cytoplasmic PLA2 has been isolated from a human monocytic leukemia cell line (16). Enhancing factor protein, found in small intestine, also belongs to the PLA2 family (17). Calcium-independent forms of PLA2 (iPLA2) have also been identified in several cell types (18) (19), and the recently cloned types IIc and V PLA2 were found to exist predominantly in mouse testis (20) and human heart tissues, respectively (21). For most of these, little is known about their function or regulation. The type V sPLA2 has recently been suggested to couple with cyclooxygenase 1 and mediate the early phase prostaglandin synthesis in mast cells as well as in several other cell types (22) (23). The classical type II sPLA2 (IIa) has also been suggested to have similar coupling with the cyclooxygenase enzymes for either the early or the late prostaglandin production depending on the cell type (24) (25) (26).

Because of considerable evidence for its preference for AA over other fatty acids, the activation of cPLA2 in particular may be critical for subsequent eicosanoid biosynthesis. Several mechanisms of activation have been demonstrated (27). Growth factor stimulation of cells has been reported to result in increased phosphorylation of cPLA2 on serine residues by either p42 MAP kinase or protein kinase C (PKC) (28) (29) (30) (31). Calcium has also been shown to have a role in cPLA2 activation, although it appears to be involved in membrane binding, where the substrate is localized, rather than in increasing catalytic activity (32). Activation of sPLA2 has been observed to occur through at least two mechanisms, one involving elevated cAMP and the other inflammatory cytokines (33). However, little is currently known about the sPLA2s in the epidermis with regard to either substrate preferences, mechanism of activation, or the role of the different forms in specific biological processes.

The purpose of this study is to investigate the role or roles some of these PLA2s may play during inflammation and tumor promotion. The release of AA in keratinocytes stimulated by the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA), bradykinin, and transforming growth factor-{alpha} (TGF{alpha}) has been shown to be mediated at least in part by activating cPLA2 (34) (35). This activation resulted in both increased enzyme activity and in the translocation of this enzyme to the membrane (35). The non-tumor promoting analog of TPA, 4{alpha}-TPA, has also been shown to stimulate the hydrolysis of AA, however, through a different mechanism (36), possibly by activating a different PLA2.

We report here the specific hydrolysis of fatty acids stimulated by different agonists using TPA, 4{alpha}-TPA, bradykinin, and calcium ionophore A23187. The partial tumor promoter calcium ionophore A23187 has been shown to stimulate the release of incorporated AA from both human and mouse keratinocytes. This apparently is different from TPA which failed to stimulate the hydrolysis of AA from human keratinocytes while significantly stimulating release of incorporated AA from mouse keratinocytes (37). We confirm here the existence of cPLA2 activity as well as mRNA in mouse keratinocytes. We also characterize and demonstrate the presence of both type I and type II sPLA2s in mouse keratinocytes as the presence of sPLA2 in epidermis has only been previously shown with immunohistological staining (38) (39).


  METHODS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
RESULTS
 DISCUSSION
 REFERENCES

Cells
Both primary keratinocytes obtained from SSIN (SENCAR) mice (University of Texas M.D. Anderson Veterinary Division, Bastrop, TX) and the murine keratinocyte cell lines: HEL-30 (34), MT1/2 (40), CH72 (40), JWF2 (40) were used in this study. Primary cultures of keratinocytes isolated from newborn mice by trypsinization were plated at 37°C and 5% CO2 in an enriched Waymouth's medium containing 10% fetal bovine serum, and switched to the completely defined, serum-free SPRD-111 medium after overnight attachment (41). HEL-30 cells were grown at 37°C and 5% CO2 in a modified Hank's buffered salt solution with 5% fetal bovine serum. For RNA isolation used in polymerase chain reaction, all cell lines were grown at 37°C and 5% CO2 in EMEM containing 8% serum and 1.2 mM calcium chloride.

Membrane and cytosolic extracts
Cells were washed with PBS and once with homogenization buffer (50 mM Tris HCl, pH 8.5) (34) (35). The homogenization buffer also contained 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 1 mM Na3VO4, 1 mM PMSF, and 10 µg/ml leupeptin. The cells were scraped into the homogenization buffer and homogenized on ice by pulse sonication for 10 sec. Homogenates were centrifuged at 560,000 g for 10 min at 4°C using a Beckman TL-100 ultracentrifuge. Cytosols for cPLA2 assay were used in the assay immediately. The protein concentrations of the cytosols were determined by the Coomassie blue reaction (Bio-Rad).

For membrane preparations, cells were washed with PBS and collected in sterile water. The cells were homogenized on ice for 20 sec using a pulse sonicator. Membrane preparations were then prepared by treatment with 0.36 N H2SO4 in 2 M NaCl overnight (pH 1.6) followed by dialysis against 10 mM acetic acid– sodium acetate buffer (pH 4.4) (42). Membranes for PLA2 assay were stored at -20°C until use. Protein concentration of the membrane preparations was determined by the Coomassie blue reaction (Bio-Rad).

Cell-free cPLA2 activity
The activity of PLA2 was measured using either the micelle assay or radiolabeled E. coli assay. Except where noted, the micelle assay measured the hydrolysis of [1-14C]arachidonic acid (AA) from L-{alpha}-1-palmityl-2-[1-14C]arachidonyl-phosphatidylcholine (PCAA) (53 mCi/mmol, 50 µCi/ml, NEN), as described by Kast, Fürstenberger, and Marks (34) (35). In the study of substrate specificity, L-{alpha}-1-palmitoyl-2-[1-14C]linoleoyl-phosphatidylcholine (PCLA) (50 mCi/mmol, 50 µCi/ml, NEN), L- {alpha}-1-palmitoyl-2-[1-14C] oleoyl-phosphatidylcholine (PCOA) (54 mCi/mmol, 50 µCi/ml, Amersham Corp.), and L-{alpha}-1-palmitoyl-2-[1-14C]arachidonyl-phosphatidylethanolamine (PEAA) (53 mCi/mmol, 50 µCi/ml, NEN) were used as substrates. The phospholipids were dried under N2, resuspended in dimethyl sulfoxide by vortexing, then mixed with cPLA2 homogenization buffer containing CaCl2 and dithiothreitol (DTT) to give a final substrate concentration of 4 mM and 10 mM, respectively. The assay was initiated by addition of 30 µl of cytosol (0.3–1 mg/ml protein) to 10 µl substrate mix to give a final substrate concentration of 0.375 µM. The assay was carried out in a 37°C water bath for 30 min. The reaction was stopped by the addition of 100 µl of ethanol containing 20 mM HCl and 0.2 ng/µl cold AA. Fifty microliters of the reaction was spotted onto a silica gel thin-layer chromatography aluminum-backed sheet (EM Separations), and the lipids separated in the organic phase of iso-octane–ethyl acetate–acetic acid–water (50:110:20: 100 (by volume). Areas containing free fatty acid or lysophospholipids and the origins were identified using iodine vapor, cut out, and the radioactivity of each spot was counted. In some experiments, the cPLA2 inhibitor, AA-derived trifluromethane (AACOCF3; Biomol), or the sPLA2 inhibitor, 1-palmitylthio-2-palmitoylamino -1,2-dioxy-sn -glycero-3-phosphocholine (thioetheramide PC; Biomol), were used; cytosols were incubated with various concentrations of inhibitors at 37°C for 10 min before the addition of substrate. In some cases, cytosol were heated to 57°C for 5 min before the addition to the reaction mix to determine thermal sensitivity. Assays were also performed with and without DTT to determine the effects of reducing agents on the activity of keratinocyte cPLA2.

Preparation of radiolabeled E. coli membrane suspension
Radiolabeled E. coli were prepared by the method of Elsbach and Weiss (43). An overnight culture of JM109 E. coli was diluted 1:20 in LB broth and incubated at 37°C for 3 h in the presence of 1 mCi/ml [14C]oleic acid (OA; NEN). Radiolabeled E. coli were then washed by incubating in fresh LB broth for 30 min followed by washing with 1% bovine serum albumin (BSA) to remove unincorporated radiolabel. The washed E. coli were autoclaved and resuspended in the appropriate amount of 0.85% saline to achieve 5,000 cpm/ul. Radiolabeled E. coli membrane suspensions were stored at -20°C until use. Typically, between 50–90% of the added [14C]OA was incorporated into E. coli.

In vitro sPLA2 assay
The sPLA2 activity was measured using radiolabeled [14C]OA E. coli membrane suspension as substrate. In the substrate specificity studies, [14C]AA E. coli and micellar substrates such as PCAA, PCLA, PCOA, and PEAA were also used. sPLA2 assay was performed with 10 µg protein from keratinocyte membrane preparation. The reaction mix contained 5 mM calcium chloride, 125 mM Tris HCl (pH 8.5), 2.5 mg/ml BSA, and 50,000 cpm [14C]OA-labeled E. coli membrane suspension. The reaction was carried out in a 37°C water bath for 30 min and was stopped by the addition of 100 µl 2 N HCl and 100 µl 20 mg/ml BSA. The reaction mix was microfuged and 250 µl supernatant was counted to monitor the [14C]OA release from the E. coli membrane. Total counts were also obtained by counting pellets as well as supernatant. In some experiments, the cPLA2 inhibitor AACOCF3, the sPLA2 inhibitor, thioetheramide PC, or the iPLA2 inhibitor, bromoenol lactone E-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one (HELSS; Biomol) were used to determine the specificity of the PLA2. Membrane preparations were heated at 57°C for 5 min, or 10 mM DTT was added in the assay in some cases to characterize the PLA2 in keratinocyte membranes.

PLA2 activity in intact cells
Confluent cultures of primary keratinocytes or HEL-30 cells were labeled with [1-14C]arachidonic acid (57 mCi/mmol, 0.1 mCi/ml, NEN), [1-14C]linoleic acid (53 mCi/mmol, 0.1 mCi/ml, NEN) or [1-14C]oleic acid (50 mCi/mmol, 0.1 mCi/ml, NEN) at a concentration of 0.3 µCi/ml medium for 16 h (28). Dishes were then washed twice with PBS and fed with fresh medium containing 1.6 µM TPA, 16 µM 4{alpha}-TPA, 0.1 µM calcium ionophore A23187, 10 µM bradykinin or vehicle. At appropriate times, aliquots of medium were counted by liquid scintillation counting. Triplicates were used at each time point.

Northern analyses
Total RNA or poly A+ RNA was isolated using GITC reagent from cultured mouse keratinocytes (100 mm2 tissue culture plates) treated with various stimuli for various time periods. Total RNA was isolated with water-saturated phenol and poly A+ RNA was isolated using QIAquick mRNA isolation kit (Qiagen). RNAs were separated on a 1% agarose–formaldehyde gel and transferred to nylon membranes. The membranes were cross-linked using a UV-cross linker (Stratagene), and hybridized with radiolabeled cPLA2 or sPLA2 cDNA probes. Hybridization was performed at 68°C for cPLA2 and 65°C for sPLA2. The washing conditions were two 15-min room temperature washes with 2 x SSC and one 30-min wash with 0.1 x SSC at 65°C for cPLA2 and 55°C for sPLA2. cPLA2 cDNA was a generous gift from Dr. Lin from the Genetics Institute (Cambridge, MA), and rat type I and type II sPLA2 cDNAs were kindly provided by the Shionogi Research Laboratory, Osaka, Japan.

Reverse transcription-polymerase chain reaction (RT-PCR)
The primers used for type I sPLA2 were 5'CAACAA CTACGGCTGCTACTGTGGC3' (SP4, forward) and 5'CGGTCACAGTTGCAGATGAAGCTCTC3' (SP5, reverse). The primers used for type II sPLA2 were 5'GGCAGAGGATCCCCCAAGGATGCCAC3' (SP1, forward) and 5'CCCTTTGCAAAACATGTTGGGG3' (SP3, reverse). First strand cDNA was synthesized using reverse transcription (RT) reaction with the Superscript(TM) kit provided by Gibco BRL. Total RNA were isolated from different sources including primary mouse keratinocytes, HEL-30 papilloma cell line from NMRI mouse (34), MT1/2 papilloma cell line from SENCAR mouse (40), CH72 squamous cell carcinoma cell line from SENCAR mouse (40), JWF2 squamous cell carcinoma cell line from SENCAR mouse (40), pancreatic cells (as a positive control for type I sPLA2), and primary small intestinal cells (as a positive control for type II sPLA2) and 1 µg of each was used as templates for the RT reaction. Oligo dT(12–18) was used as a primer for the RT reaction. The cDNA templates generated from the RT reactions were used in PCR reaction with SP1–SP3 primers or SP4–SP5 primers (Genosys) and Taq DNA polymerase (Roche). The conditions for PCR reaction were: 63°C for annealing, 72°C for elongation, and 94°C for denaturing, and the reaction was performed for 45 cycles. The products from the PCR reaction were visualized on a 2% agarose gel and transferred to nylon membranes for Southern analysis. The PCR products were then subjected to restriction analysis to partially confirm their identity. The confirmed PCR products were subcloned into an Invitrogen cloning vector, pCRTMII (3.9 kb) using a TA cloning kit (Invitrogen) and used to transform DH5{alpha}(TM) competent E. coli (maximum efficiency, Gibco BRL) before sequencing. Sequencing was performed by the Molecular Biology Service Core at Science Park, Smithville, TX. Sequences of the keratinocyte PCR products were compared with those of the pancreatic and the small intestinal PCR products as well as the published rat (44) and mouse (45) type I and type II sPLA2 sequences, respectively.

Southern analysis
The nylon membranes with PCR products were cross-linked using a UV-cross linker (Stratagene), and hybridized with radiolabeled type I or type II sPLA2 cDNA probes. The probed membranes were then washed and exposed to X-ray film (Eastman Kodak, Rochester, NY) for detection.

Statistical analyses
Results are expressed as means ± standard errors of triplicate data; all data were subjected to one-way analysis of variance (ANOVA) test. When significant differences were detected, Tukey's honest significant difference test was used for multiple comparisons among the groups. Whenever applicable, Student's t test was used to determine the differences between two samples. P <= 0.05 was considered significant.


  RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
DISCUSSION
 REFERENCES

Differential activation of cPLA2 and sPLA2 in keratinocytes
The level of phospholipase activity in cultured keratinocytes was determined by the release of incorporated fatty acid from [14C]AA-, LA-, or OA-prelabeled cells in the presence or absence of either TPA (1.6 µM) 4{alpha}-TPA (16 µM), calcium ionophore A23187 (0.1 µM), or bradykinin (10 µM). Incorporation of radiolabeled fatty acids was equal in all cell lines and cultures and equilibrium was reached at around 8–9 h (37). The incorporation of AA into PC was not greater than incorporation of LA or OA (data not shown). The time course of the release of the incorporated fatty acids from keratinocytes is shown in Figure 1. The release of incorporated AA from both HEL-30 cells (data not shown) and cultured primary keratinocytes occurred in a time-dependent manner and reached a maximum at approximately 3 h with or without treatment with TPA. Compared to vehicle control, TPA enhanced the release of incorporated AA from cultured keratinocytes by about 3- to 3.5-fold (Figure 1A). Compared to the release of AA, the release of incorporated LA and OA was significantly reduced. An initial increase in LA and OA release was observed at 30 min, possibly due to changing the medium, with no further increase. The maximum release of LA and OA at 3 h was only one-third that of AA (Figure 1A). A similar trend was also observed with bradykinin, although with a different time course than observed with TPA. The maximum release of incorporated AA was observed at 30 min with bradykinin treatment rather than 3 h with TPA treatment (Figure 1B). Bradykinin also appeared to reduce the basal level of incorporated OA hydrolysis by approximately 20%. (Figure 1B)



View larger version (23K):
[in this window]
[in a new window]
  		Figure 1. Release of fatty acids from pre-labeled keratinocytes treated with different stimuli. Primary cultures of keratinocytes were pre-labeled with either 0.3 µCi/ml [14C] arachidonic acid ({bullet}), [14C]linoleic acid ({blacktriangleup}), or [14C]oleic acid ({blacksquare}) for 16 h. Washed cells were then treated with either A: 1.6 µM TPA; B: 10 µM bradykinin; C: 16 µM 4{alpha}-TPA; or D: 0.1 µM calcium ionophore A23187. At indicated time points 100 µl media was taken and the radioactivity was counted. Data points were mean ± SEM, n = 3.

A different fatty acid release profile was produced when 4{alpha}-TPA and calcium ionophore A23187 were used as agonists (Figure 1C and Figure D). Continuous release was observed for the 3 h duration of the experiment for all three fatty acids incorporated, and no preference was observed for AA or any other fatty acids measured. The differential hydrolysis of AA, LA, and OA with 4{alpha}-TPA and calcium ionophore A23187, compared to TPA and bradykinin, was consistent with the involvement of diverse mechanisms, possibly the activation of cPLA2 and sPLA2. To investigate whether these two forms of PLA2s exist in mouse keratinocytes, the distinctive biochemical and enzymatic properties of the two enzymes were used to characterize the cPLA2 and the sPLA2 in mouse keratinocytes.

PLA2 activity in cytosol versus membrane
PLA2 activities were detected in both cytosol and membrane fractions of mouse epidermal keratinocytes ( Figure 2). These activities appeared to be dependent on the protein concentrations of the preparations. As shown in Figure 3A, PLA2 isolated from the cytosolic fraction of keratinocytes exhibited a clear substrate specificity. Keratinocyte cPLA2 preferentially hydrolyzed the release of incorporated AA esterified to the sn -2 position of phosphatidylcholine (PC). The release of incorporated LA or OA esterified to PC is less than 50% of that released when PC-AA was used as the substrate (Figure 3A). Other phospholipids, such as AA esterified to phosphatidylethanolamine, were not readily used as substrates by keratinocyte cPLA2 (Figure 3A). The PLA2 activity of keratinocyte cytosol using E. coli membrane suspension, a preferred substrate form for sPLA2 (46), is also minimal (1.4% and 0.6%, respectively, for AA- and OA-labeled E. Coli). Keratinocyte membrane preparations, however, preferentially catalyzed the release of fatty acids presented in the form of E. coli membranes (Figure 3B). On the other hand, even though the hydrolysis of AA by membranes from keratinocytes is twice that of OA, both AA and OA in the form of E. coli membrane suspension were significantly hydrolyzed by keratinocyte membrane preparations and both fatty acids served as substrates for membrane PLA2 (Figure 3B). The activity of keratinocyte membrane preparations towards micellar substrates was almost negligible as compared to when E. coli membrane suspensions were used as substrates (Figure 3B). The crude extract of keratinocyte membrane also appears to contain an inhibitor that reduces the activity of a purified pancreatic sPLA2 by half (data not shown). This inhibitor, the identity of which is unknown, was inactivated or removed when acid extraction was performed on the particulate cell fraction.



View larger version (13K):
[in this window]
[in a new window]
  		Figure 2. Protein dependence of PLA2 activity from keratinocyte membrane and cytosol. Keratinocyte cytosol and membrane cell fractions were extracted as described under Methods. Indicated amounts of protein were used in each assay. cPLA2 and sPLA2 assays were performed, and the activities of these enzymes were expressed as % fatty acid (FA) release. A, keratinocyte cytosol; B, keratinocyte membrane.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 3. Substrate specificity of PLA2s isolated from mouse keratinocytes. Cytosolic and membrane fractions of keratinocytes were assayed with different forms of substrates, including micellar substrates as well as E. coli membrane suspensions as substrates. PC-AA, phosphatidylcholine-arachidonic acid; PC-LA, phosphatidylcholine-linoleic acid; PC-OA, phosphatidylcholine-oleic acid; PE-AA, phosphatidylethanolamine-arachidonic acid; AA E. coli, arachidonic acid-labeled E. coli membrane; OA E. coli, oleic acid-labeled E. coli membrane. A: keratinocyte cytosol; B: keratinocyte membrane preparations. Data points were mean ± SEM, n = 3. *, Bars with different numbers of asterisks are statistically different from each other (P < 0.05).

Effect of calcium, heat, acid, and reducing agents
To further characterize and establish the uniqueness of membrane and cytosolic PLA2 s, enzyme activities in the presence of various calcium concentrations, high heat conditions, or reducing agents were assessed. Calcium is an absolute requirement in the action of both cPLA2 and sPLA2 even though its roles in sPLA2 and cPLA2 activation are different (30) (47) (48). Calcium resides at the catalytic center of sPLA2 and is directly involved in substrate-enzyme interactions (48). For cPLA2 activation, calcium is not required for catalytic activity; rather, it is involved in the translocation of cPLA2 from cytosol to the membrane where the substrates are located (27) (28) (44). When calcium concentrations were varied in the keratinocyte PLA2 assays, different responses were observed with cytosol and membrane cell preparations ( Figure 4). These different responses suggested that these PLA2s are indeed different forms. Increasing the calcium concentration from 0 to 10 mM dose-dependently enhanced the PLA2 activity of keratinocyte cytosol, with a plateau at 4 mM (Figure 4A). This apparent high requirement of keratinocyte cytosolic PLA2 could be the result of the EDTA and EGTA which are present in the extraction buffer. The membrane PLA2, however, has an optimum Ca2+ requirement of 1 mM (Figure 4B). Lower and higher Ca2+ in the reaction reduced the PLA2 activity of keratinocyte membrane preparations. However, substantial activity was still observed when no Ca2+ was added. Therefore, EDTA was introduced to chelate endogenous calcium. While EDTA significantly reduced the PLA2 activity of keratinocyte membrane preparations, up to 5 mM EDTA failed to completely inhibit PLA2 activity in this cell fraction (Figure 4B), suggesting the possible presence of other mechanisms of fatty acid hydrolysis.



View larger version (53K):
[in this window]
[in a new window]
  		Figure 4. Effects of calcium concentration on the activities of keratinocyte PLA2s. Calcium concentration was varied in the assay from 0 to 10 mM. A: keratinocyte cytosol; B: keratinocyte membrane preparation. In panel B, various amount (mM) of calcium chloride or EDTA. Data points were mean ± SEM, n = 3. a,b,c, Bars assigned different letters are significantly different from each other (P < 0.05).

The structural differences between cPLA2 and sPLA2 provide them with distinct biochemical characteristics that can be used to distinguish the two enzymes. The seven disulfide bonds have been reported to provide sPLA2 (14kD) with resistance to heating and acid; however, it is sensitive to reducing reagent (49). The cPLA2 is a much larger protein (85 kD) which lacks those disulfide bonds (50). Therefore, cPLA2 is much more sensitive to heating and acid treatment and is nonresponsive to reducing reagents. As shown in Figure 5A, the cytosolic fraction has the classic characteristics of cPLA2. It is sensitive to heating and acid treatment, and resistant to the reducing reagent DTT. Incubation of keratinocyte cytosol with 10 mM DTT only marginally reduced PLA2 activity in this cell fraction, and sometimes it even slightly enhanced this PLA2 activity (data not shown). However, heating cytosols for 5 min at 57°C significantly reduced PLA2 activity by 80%, and acid treatment with an equal volume 0.36 N H2SO4 completely inhibited cPLA2 activity of keratinocyte cytosols (Figure 5A). On the other hand, keratinocyte membranes demonstrated just the opposite responses to these treatments. The PLA2 activity of this cell fraction was sensitive to DTT treatment and resistant to heating and acid treatment. Treatment with 10 mM DTT reduced PLA2 activity of keratinocyte membrane by 86.6% (Figure 5B). Neither heating at 57°C for 5 min nor acid treatment altered this PLA2 activity. In fact, due to the existence of the putative endogenous inhibitor, acid extraction with 0.36 N H2SO4 overnight was required in order to obtain an active PLA2 from keratinocyte membranes.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 5. Effects of heating, reducing reagent, and acid treatment on the activities of keratinocyte PLA2s. cPLA2 and sPLA2 assays were performed with or without reducing reagent DTT. Keratinocyte cell fractions were either heated at 57°C for 5 min (Heat), with equal volume of 0.36 N H2SO4 (Acid), or not treated (NT). A: keratinocyte cytosol; B: keratinocyte membrane preparations. Data points were mean ± SEM, n = 3. *, Bars with asterisks are significantly different from others at P < 0.05.

Effects of specific inhibitors
To study the role of different PLA2s in eicosanoid production as well as other functions, considerable effort has been put into developing specific inhibitors for different PLA2s. Of these inhibitors, the substrate analog, thioetheramide-PC showed specific selectivity towards human recombinant sPLA2 (IC50 = 0.9 µM) with little or no effect on cPLA2 from monocyte U937 cells (51). An iPLA2 inhibitor, HELSS, has recently been developed that irreversibly inhibits iPLA2. This inhibitor was shown to be specific for iPLA2 with half-maximal inhibition observed at 60 nM after 5 min incubation (52). The iPLA2 was also inhibited by the widely used cPLA2 inhibitor, trifluoromethyl ketone (AACOCF3). The trifluoromethyl ketone is an analog of AA that slowly but tightly binds to cPLA2 and calcium. The formation of the complex Ca2+–AACOCF3–cPLA2 inhibits the enzyme from hydrolyzing AA from phospholipids (53).

To verify the identity of these two PLA2s in keratinocytes, these inhibitors were used in the assay. The cPLA2-specific inhibitor AACOCF3 (53) dose-dependently inhibited the PLA2 activity of keratinocyte cytosol while the sPLA2-specific inhibitor thioetheramide PC (51) failed to do so ( Figure 6). When 50 µM AACOCF3 was used in the reaction, the PLA2 activity of keratinocyte cytosol was almost eliminated (Figure 6). However, when the same amount of AACOCF3 was used with keratinocyte membrane preparations, the PLA2 in this cell fraction remained active ( Figure 7A). Similarly, when 10 µM thioetheramide PC was incubated with keratinocyte cytosol, the PLA2 activity was only marginally reduced compared to when no inhibitor was added (Figure 6). This may be due to the cross-reactivity of this inhibitor with cPLA2 at high dose. However, thioetheramide PC dose-dependently inhibited the PLA2 activity of keratinocyte membrane with an IC50 of approximately 1 µM (Figure 7B). Addition of 50 µM thioetheramide PC in the assay almost abolished the PLA2 activity of this cell fraction. Addition of up to 500 nM HELSS, an iPLA2 inhibitor (52), was also ineffective (Figure 7C).



View larger version (41K):
[in this window]
[in a new window]
  		Figure 6. Effect of PLA2 inhibitors on keratinocyte cytosolic PLA2 activity. Indicated amount of cPLA2 inhibitor, AACOCF3 or sPLA2 inhibitor thioetheramid-PC (Thioamide-PC) were used in the assay with keratinocyte cytosol. Data points were mean ± SEM, n = 3. Bars with asterisks are significantly different from others at P < 0.05.



View larger version (32K):
[in this window]
[in a new window]
  		Figure 7. Effect of PLA2 inhibitors on keratinocyte membrane PLA2 activity. Indicated amount of cPLA2 inhibitor, AACOCF3 (A); sPLA2 inhibitor, thioetheramide-PC (Thioamide-PC) (B); or calcium independent PLA2 inhibitor, HELSS (C) were used in the assay with keratinocyte membranes. Data points were mean ± SEM, n = 3. Bars with different letters are significantly different from each other at P < 0.05.

Expression of cPLA2 and sPLA2 mRNA in keratinocytes
The enhanced hydrolysis of AA but not LA or OA after TPA treatment of keratinocytes suggests that TPA activates cPLA2 but not sPLA2. In agreement with the work of Kast et al. (34) with HEL-30 cells, we also found that cPLA2 activity of HEL-30 cells was elevated by 50% 10–30 min after treatment of the cells with 1 µg/ml TPA (data not shown). However, no change was detected at the transcription level using Northern analysis of RNA isolated after TPA treatment of HEL-30 cells (data not shown).

To determine whether the sPLA2 was type I or type II, total RNA (30 µg) or poly A+ RNA (from two 100 mm2 dishes), respectively, were isolated from treated cultured keratinocytes. Total RNA (5 µg) isolated from pancreas and small intestine were also loaded on the gels as positive controls for type I and type II sPLA2, respectively (54) (55). Type I and type II sPLA2 cDNA probes produced the expected signal at 0.85 kb in pancreas and small intestine after overnight exposure to the film. However, no signals were detected in mouse keratinocytes even after treatment with TPA or calcium ionophore A23187 and an exposure time of 1 week (data not shown).

To determine whether sPLA2s were expressed at low levels in keratinocytes, reverse transcriptase-PCR was used to detect type I and type II sPLA2 in primary keratinocytes as well as established cell lines. Both no template and RNA only were included as negative controls for the possible presence of contaminated cDNA. Bands corresponding to the predicted sizes (234 bp for type I sPLA2 and 269 bp for type II sPLA2) were observed in almost all cell types ( Figure 8). Sequence comparison demonstrated that the PCR products from primary keratinocytes and pancreatic cells using SP4-SP5 primers shared 93.5% homology, and they shared 92.4% and 89.5% homology with the partial sequence of rat pancreatic type I sPLA2 (44), respectively. The type II sPLA2 PCR products from primary keratinocytes and small intestine have the same sequence and they shared 99.6% homology with the reported type II sPLA2 sequence for mouse small intestine (45). The type I sPLA2 appeared to be expressed in slightly higher levels in the less transformed cells (primaries and HEL-30 cells) than in the more transformed cell types (MT1/2, CH72, and JWF2 cells) (Figure 8A). On the other hand, the type II sPLA2 were expressed at a similar level in all cell types except the JWF2 cells, where it was not expressed (Figure 8B). Southern analysis of the PCR products verified the identity of these products to be type I and type II sPLA2 (Figure 8C and Figure D). Interestingly, the primers for type II sPLA2 also picked up two additional bands in the transformed cell lines (HEL-30, MT1/2, and CH72 cells). These two bands were not present in the primary keratinocytes (Figure 8B). The identity of these products is not clear. However, analysis of their sequence shows that they do share homology with the mouse type II sPLA2 cDNA.



View larger version (73K):
[in this window]
[in a new window]
  		Figure 8. Expression of type I and type II sPLA2 mRNA in cultured mouse keratinocytes as detected by RT-PCR. One µg total RNA was used for each RT-PCR reaction. RT-PCR was performed as described under Methods. One µg total RNA from pancreas and small intestine was also amplified as positive controls for type I and type II sPLA2, respectively. The predicted bands corresponding to type I sPLA2 (234 bp) and type II sPLA2 (269 bp) were detected in both cell lines and positive controls. A: amplification of type I sPLA2; B: amplification of type II sPLA2; C: Southern analysis of the blot in panel A; D: Southern analysis of the blot in panel B. Lines point to the size of sPLA2 signals.


  DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
REFERENCES

The specificity for AA release in keratinocytes activated by TPA and bradykinin is shown in this paper. Calcium ionophore A23187 and 4{alpha}-TPA, on the other hand, do not show this fatty acid specificity. These observations suggest that different mechanisms might exist in mouse keratinocytes for the hydrolysis of fatty acids. The most direct mechanism is through PLA2, which hydrolyzes the hydrolysis of sn -2 fatty acids from membrane phospholipids. Others include the phospholipase C and phospholipase D pathways with an additional step catalyzed by diacylglycerol lipase. The phospholipase C or D pathway does not appear to play a major role in the diversity of fatty acid release observed in mouse keratinocytes as no differences in radiolabeled phosphatidic acid were found with treatments using different agonists (data not shown). Therefore, activation of different members of the PLA2 family might be responsible for the differential hydrolysis profile stimulated with different agonists.

The two classic types of PLA2s are sPLA2 and cPLA2. cPLA2 has been reported to preferentially hydrolyze AA from the sn -2 position of phosphatidylcholine (PC) in a variety of cell types, including macrophages and platelets (7) (8). We show here that PLA2 from the cytosolic fraction of keratinocytes exhibited similar substrate specificity. This PLA2 also showed the classic biochemical characteristics of cPLA2 with the exception of the requirement of calcium. The divergence of calcium requirement we observed in this paper, as compared to that of previous ones, is not clear. The presence of EDTA and EGTA in the extraction buffer may be a contributing factor to the increase of calcium requirement in the in vitro assay. However, it had also been observed that under in vitro conditions, the calcium requirement of cPLA2 differs from that of in vivo conditions (56). A biphasic response curve has also been observed for calcium in human keratinocytes (56). A cPLA2 inhibitor AACOCF3 was also shown to readily inhibit the PLA2 activity of keratinocyte cytosol. While this inhibitor may also inhibit iPLA2, the requirement of calcium for enzyme activity clearly demonstrated that this PLA2 activity indeed is from cPLA2. Therefore, in agreement with the work of Kast et al. (34) (35) in keratinocytes, we conclude that mouse keratinocyte cytosol possesses a classic cPLA2.

The effect of TPA on AA hydrolysis was at least partially mediated by cPLA2 as data from our laboratory as well as from Kast et al. (35) demonstrated that TPA stimulated the activation of cPLA2 at 15 and 30 min. The lack of concordance in the time course of AA release and cPLA2 activation suggests the involvement of additional mechanisms in the hydrolysis of AA. The initial release of AA mediated by cPLA2 could signal the subsequent activation of a variety of other pathways which may include other PLA2s, such as sPLA2. Several recent reports have suggested that stimulation of one PLA2 and the subsequent production of eicosanoids as well as platelet activating factor (PAF) may lead to the activation of one or more other PLA2s (22) (23) (24) (25) (26).

Unlike cPLA2, sPLA2 has no preference for the type of fatty acid at the sn-2 position. It hydrolyzes OA as well as AA as long as the fatty acid is esterified to the sn -2 position of the phospholipids. We show here that PLA2 from keratinocyte membrane preparations hydrolyzed both AA- and OA-labeled E. coli membrane. In keratinocytes, the particular form of sPLA2 had not been previously identified although the existence of a sPLA2 in human keratinocytes has been suggested (38). However, this sPLA2 was only detected in the more differentiated epidermis using immunofluorescence staining with antibodies against human recombinant type II sPLA2 (38). In this paper, we provide evidence that mouse keratinocytes possess a form (or forms) of phospholipase with the established characteristics of sPLA2. These characteristics are in keeping with the importance of disulfide bonds in stabilizing the structure of sPLA2, and with the dependency of catalytic activity of sPLA2 on calcium. Therefore, we suggest that one or more forms of sPLA2 are expressed in mouse keratinocyte membrane. The existence of a sPLA2 in mouse keratinocytes is confirmed by a recent report suggesting sPLA2 is required for maintaining permeability barrier homeostasis in mouse epidermis (39). Using RT-PCR with primers based on the rat pancreatic type I and mouse small intestinal type II sPLA2 sequence, the predicted products were detected in mouse keratinocytes with homologies to the type I and type II sPLA2, respectively. These results suggested that both type I and type II sPLA2 exist in mouse keratinocytes and that they are expressed in low abundancy.

Using antisense transfections, we have shown that cPLA2 activation is partially responsible for the specificity of AA release observed in keratinocytes treated with TPA (unpublished data). The activation of cPLA2 by TPA may be a direct or indirect result of activated PKC as an unequivocal effect of TPA is to activate PKC (57). The hydrolysis of LA and OA stimulated by calcium ionophore A23187 and 4{alpha}-TPA is likely to be the result of activation of sPLA2 although direct evidence for activation of sPLA2 by calcium ionophore A23187 and 4{alpha}-TPA has not yet been demonstrated. The mechanisms by which sPLA2 may be activated are also not clear. Some cytokines such as interleukin (IL)-6, IL-1 and tumor necrosis factor have been shown to transcriptionally up-regulate type II sPLA2 in immune cells as well as in astrocytes and mesangial cells (58) (59) (60). Post-translational activation by protease has also been suggested for two forms of sPLA2 (20) (61). The signaling pathways involved in the activation of sPLA2 have also not yet been defined, but the possible involvement of one or multiple forms of G protein has been suggested (62) (63). The inhibition of OA hydrolysis by bradykinin might be a result of activation of a G protein (34) and subsequent inhibition of sPLA2.

In conclusion, we have identified and characterized three forms of PLA2 in keratinocytes, cPLA2 in cytosol, and a type I and a type II sPLA2 in the membrane. These PLA2s differ in their substrate specificities and thus may produce the agonist-specific fatty acid release observed with different stimuli. Keratinocyte cPLA2 is at least partially responsible for the specific hydrolysis of AA from mouse keratinocytes. The type I and II sPLA2 may be responsible for the non-specific hydrolysis of other fatty acids from mouse keratinocytes through unknown mechanisms.


  ACKNOWLEDGMENTS

This work was supported by NCI grants CA-34443 and CA-46886 (SMF) and NCI Comprehensive Cancer Center grant CA-16672. Bangyan Li-Stiles is supported by the NIEHS-T32-ES07247 Toxicology Training Grant.

Manuscript received July 1, 1997; and in revised form November 3, 1997.

Abbreviations: AA, arachidonic acid; cPLA2, cytosolic phospholipase A2; DTT, dithiothreitol; LA, linoleic acid; OA, oleic acid; PCAA, 1-palmitoyl-2-arachidonyl-phosphatidylcholine; PCLA, l-palmitoyl-2-linoleoyl-phosphatidylcholine; PCOA, 1-palmitoyl-2-oleoyl-phosphatidylcholine; PEAA, 1-palmitoyl-2-arachidonyl phosphatidylethanolamine; PKC, protein kinase C; PLA2, phospholipase A2; PG, prostaglandin; sPLA2, secretory phospholipase A2; TPA, 12-O-tetra- decanoylphorbol 13-acetate


  REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES

  1. Black, A. K., Greaves, M. W., Hensby, C. N., Plummer, N. A., Warin, A. P. 1978. The effects of indomethacin on arachidonic acid and prostaglandins E2 and F2alpha levels in human skin 24 h after U.V.B and U.V.C. irradiation. Br. J. Clin. Pharmacol. 6:261-266[Medline].

  2. Marks, F., Hanke, B., Thastrup, O., Fürstenberger, G. 1991. Stimulatory effect of thapsigargin, a non-TPA-type tumor promoter on arachidonic acid metabolism in the mouse keratinocyte line HEL 30 and on epidermal cell proliferation in vivo as compared to the effects of phorbol ester TPA. Carcinogenesis. 12:1491-1497[Abstract/Free Full Text].

  3. Fürstenberger, G., and F. Marks. 1990. The role of eicosanoids in normal hyperplastic and neoplastic growth in mouse skin. In Eicosanoids and the Skin. T. Ruzicka, editor. CRC Press, Boca Raton, FL. 107–124.

  4. Bonta, J. L., Parnham, M. J. 1978. Prostaglandins and chronic inflammation. Biochem. Pharmacol. 27:1611-1623[Medline].

  5. Fürstenberger, G., M. Gross, and F. Marks. 1982. On the role of prostaglandins in the induction of epidermal proliferation, hyperplasia and tumor promotion in mouse skin. In Prostaglandins and Cancer: First International Conference. Vol. II. T. J. Powles, R. S. Bockman, K. V. Honn, and P. Ramwell, editors. Alan R. Liss, New York. 239–254.

  6. Honn, K. V., Tang, D. G., Gao, X., Butovich, I. A., Liu, B., Timar, J., Hagmann, W. 1994. 12-Lipoxygenases and 12(S)-HETE: role in cancer metastasis. Cancer Metastasis Rev. 13:365-396[Medline].

  7. Hagerman, R. A., S. M. Fischer, and M. F. Locniskar. 1995. Modulation of keratinocyte differentiation by fatty acids. Eighty-Six Annual Meeting of American Association for Cancer Research. 36: 3080.

  8. Smith, W. L. 1992. Prostanoid biosynthesis and mechanisms of action. Am. J. Physiol. 263:F181-F191[Abstract/Free Full Text].

  9. Bereziat, G., Etienne, J., Kokkinidis, M., Oliviera, J. L., Pernas, P. 1990. New trends in mammalian non-pancreatic phospholipase A2 research. J. Lipid Mediat. 2:159-172[Medline].

  10. Cox, P., Squier, C. A. 1986. Variations in lipids in different layers of porcine epidermis. J. Invest. Dermatol. 87:741-744[Medline].

  11. Elias, P. M., Cooper, E. R., Korc, A., Brown, B. E. 1981. Percutaneous transport in relation to stratum corneum structure and lipid composition. J. Invest. Dermatol. 76:297-301[Medline].

  12. Boyce, S. T., Williams, M. L. 1993. Lipid-supplemented medium induces lamellar bodies and precursors of barrier lipids in cultured analogues of human skin. J. Invest. Dermatol. 101:180-184[Medline].

  13. Grayson, S., Elias, P. M. 1982. Isolation and lipid biochemical characterization of stratum corneum membrane complexes: implications for the cutaneous permeability barrier. J. Invest. Dermatol. 78:128-135[Medline].

  14. Grubauer, G., Feingold, K. R., Harris, R. M., Elias, P. M. 1989. Lipid content and lipid type as determinants of the epidermal permeability barrier. J. Lipid Res. 30:89-96[Abstract].

  15. Du, X., Harris, S. J., Tetz, T. J., Ginsberg, M. H., Berndt, M. C. 1994. Association of a phospholipase A 2 (14-3-3 protein) with the platelet glycoprotein Ib-IX complex. J. Biol. Chem. 269:18287-18290[Abstract/Free Full Text].

  16. Diez, E., Mong, S. 1990. Purification of a phospholipase A2 from human monocytic leukemic U937 cell. J. Biol. Chem. 265:15654-15661.

  17. Mulherkar, R., Rao, R., Rao, L., Patki, V., Chauhan, V. S., Deo, M. G. 1993. Enhancing factor protein from mouse small intestines belongs to the phospholipase A 2 family. FEBS Lett. 317:263-266[Medline].

  18. Ackermann, E. J., Kempner, E. S., Dennis, E. A. 1994. Ca2+-independent cytosolic phospholipase A 2 from macrophage-like P388D1 cells. J. Biol. Chem. 269:9227-9233[Abstract/Free Full Text].

  19. Lehman, J. J., Brown, K. A., Ramanadham, S., Turk, J., Gross, R. W. 1993. Arachidonic acid release from aortic smooth muscle cells induced by [arg8]vasopressin is largely mediated by calcium-independent phospholipase A2. J. Biol. Chem. 268:20713-20716[Abstract/Free Full Text].

  20. Chen, J., Engle, S. J., Seilhamer, J. J., Tischfield, J. A. 1994. Cloning and characterization of novel rat and mouse low molecular weight Ca2+-dependent phospholipase A2s containing 16 cysteines. J. Biol. Chem. 269:23018-23024[Abstract/Free Full Text].

  21. Chen, J., Engle, S. J., Seilhamer, J. J., Tischfield, J. A. 1994. Cloning and recombinant expression of a novel human low molecular weight Ca2+-dependent phospholipase A2. J. Biol. Chem. 269:2365-2368[Abstract/Free Full Text].

  22. Reddy, S. T., Winstead, M. V., Tischfield, J. A., Herschman, H. R. 1997. Analysis of the secretory phospholipase A2 that mediates prostaglandin production in mast cells. J. Biol. Chem. 272:13591-13596[Abstract/Free Full Text].

  23. Balboa, M. A., Balsinde, J., Winstead, M. V., Tischfield, J. A., Dennis, E. A. 1996. Novel group V phospholipase A2 involved in arachidonic acid mobilization in murine P388D1 macrophages. J. Biol. Chem. 271:32381-32384[Abstract/Free Full Text].

  24. Fonteh, A. N., Bass, D. A., Marshall, L. A., Seeds, M., Samet, J. M., Chilton, F. H. 1994. Evidence that secretory phospholipase A2 plays a role in arachidonic acid release and eicosanoid biosynthesis by mast cells. J. Immunol. 152:5438-5446[Abstract].

  25. Murakami, M., Kuwata, H., Amakasu, Y., Shimbara, S., Nakatani, Y., Atsumi, G., Kudo, I. 1997. Prostaglandin E2 amplifies cytosolic phospholipase A2- and cyclooxygenase-2-dependent delayed prostaglandin E2 generation in mouse osteoblastic cells. J. Biol. Chem. 272:19891-19897[Abstract/Free Full Text].

  26. Ashraf, M. M., Murakami, M., Shimbara, S., Amakasu, Y., Atsumi, G., Kudo, I. 1996. Type II phospholipase A2 is linked to cyclooxygenase-2-mediated delayed prostaglandin D2 generation by cultured mouse mast cells following FcepsilonRI- and cytokine-dependent activation. Biochem. Biophys. Res. Commun. 229:726-732[Medline].

  27. Paglin, S., Roy, R., Polgar, P. 1993. Characterization of hormonally regulated and particulate-associated phospholipase A2 from bovine endothelial cells. J. Biol. Chem. 268:11697-11702[Abstract/Free Full Text].

  28. Lin, L-L., Wartmann, M., Lin, A. Y., Knopf, J. L., Seth, A., Davis, R. J. 1993. cPLA2 is phosphorylated and activated by MAP kinase. Cell. 72:269-278[Medline].

  29. Nemenoff, R. A., Winitz, S., Qian, N-X., Van Patten, V., Johnson, G. L., Heasley, L. E. 1993. Phosphorylation and activation of a high molecular weight form of phospholipase A2 by p42 micro-tubule associated protein kinase and protein kinase C. J. Biol. Chem. 268:1960-1964[Abstract/Free Full Text].

  30. Wijkander, J., Sundler, R. 1992. An 100-kDa arachidonate-mobilizing phospholipase A2 in mouse spleen and the macrophage cell line J774. FEBS Lett. 311:299-301[Medline].

  31. Lin, L-L., Lin, A. Y., Knopf, J. L. 1992. Cytosolic phospholipase A2 is coupled to hormonally regulated release of arachidonic acid. Proc. Natl. Acad. Sci. USA. 89:6147-6151[Abstract/Free Full Text].

  32. Yoshihara, Y., Watanabe, Y. 1990. Translocation of phospholipase A2 from cytosol to membranes in rat brain induced by calcium ions. Biochem. Biophys. Res. Commun. 170:484-490[Medline].

  33. Nakano, T., Ohara, O., Teraoka, H., Arita, H. 1990. Group II phospholipase A2 mRNA synthesis is stimulated by two distinct mechanisms in rat vascular smooth muscle cells. Fed. Eur. Biochem. Soc. 261:171-174.

  34. Kast, R., Fürstenberger, G., Marks, F. 1993. Phorbol ester TPA- and bradykinin-induced arachidonic acid release from keratinocytes is catalyzed by a cytosolic phospholipase A2 (cPLA2). J. Invest. Dermatol. 101:567-572[Medline].

  35. Kast, R., Fürstenberger, G., Marks, F. 1993. Activation of cytosolic phospholipase A2 by transforming growth factor-{alpha} in HEL-30 keratinocytes. J. Biol. Chem. 268:16795-16802[Abstract/Free Full Text].

  36. Fischer, S. M., Patrick, K. E., Lee, M. L., Cameron, G. S. 1991. 4ß and 4{alpha}-12-o-tetradecanoylphorbal-13-acetate elicit arachidonate release from epidermal cells through different mechanisms. Cancer Res. 51:850-856[Abstract/Free Full Text].

  37. Cameron, G. S., Naylor, M., Morris, R. J., Haynes, A., Patrick, K. E., Lee, M., Fischer, S. M. 1992. Tumour promoter-induced release and metabolism of arachidonic acid: comparison between mouse and human epidermal cells. Toxicol. in Vitro. 6:109-118.

  38. Anderson, S., Sjursen, W., Lægreid, A., Volden, G., Johansen, B. 1994. Elevated expression of human nonpancreatic phospholipase A2 in psoriatic tissue. Inflammation. 18:1-12[Medline].

  39. Mao-Qiang, M., Jain, M., Feingold, K. R., Elias, P. M. 1996. Secretory phospholipase A2 activity is required for permeability barrier homeostasis. J. Invest. Dermatol. 106:57-63[Medline].

  40. Conti, C. J., Fries, J. W., Viaje, A., Miller, D. R., Morris, R., Slaga, T. J. 1988. In vivo behavior of murine epidermal cell lines derived from initiated and noninitiated skin. Cancer Res. 48:435-439[Abstract/Free Full Text].

  41. Morris, R. J., Tacker, K. C., Baldwin, J. K., Fischer, S. M., Slaga, T. J. 1987. A new medium for primary cultures of adult murine epidermal cells: application to experimental carcinogenesis. Cancer Lett. 34:297-304[Medline].

  42. Märki, F., Franson, R. 1986. Endogenous suppression of neutral-activated and calcium-dependent phospholipase A2 in human polymorphonuclear leukocytes. Biochim. Biophys. Acta. 879:149-156[Medline].

  43. Elsbach, P., Weiss, J. 1991. Utilization of labeled. Escherichia coli as(phospholipase substrate. Methods Enzymol. 197):24-31.

  44. Ohara, O., Tamaki, M., Nakamura, E., Tsuruta, Y., Fujii, Y., Shin, M., Teraoka, H., Okamoto, M. 1986. Dog and rat pancreatic phospholipases A2: complete amino acid sequences deduced from complementary DNAs. J. Biochem. 99:733-739[Abstract/Free Full Text].

  45. MacPhee, M., Chepenik, K. P., Liddell, R. A., Nelson, K. K., Siracusa, L. D., Buchberg, A. M. 1995. The secretory phospholipase A2 gene is a candidate for the Mom1 locus, a major modifier of Apcmin-induced intestinal neoplasia. Cell. 81:957-966[Medline].

  46. Bolognese, B., Marshall, L. A. 1993. Use of radiolabeled. E. coli as(a substrate to assess phospholipase activity. DuPont Biotech Update. Fall):62-64.

  47. Nalefski, E. A., Sultzman, L. A., Martin, D. M., Kriz, R. W., Towler, P. S., Knopf, J. L., Clark, J. D. 1994. Delineation of two functionally distinct domains of cytosolic phospholipase A2, a regulatory Ca2+-dependent lipid binding domain and a Ca2+-independent catalytic domain. J. Biol. Chem. 269:18239-18249[Abstract/Free Full Text].

  48. Scott, D. L., White, W. P., Browning, J. L., Rosa, J. J., Gelb, M. H., Sigler, P. B. 1991. Structure of free and inhibited human secretory phospholipase A2 from inflammatory exudate. Science. 254:1007-1010[Abstract/Free Full Text].

  49. Wery, J. P., Schevitz, R. W., Clawson, D. K., Bobbitt, J. L., Dow, E. R., Gamboa, G., Goodson, T., Jr., Hermann, R. B., Kramer, R. M., McClure, D. B., Mihelich, E. D., Putnam, J. E., Sharp, J. D., Stark, D. H., Teater, C., Warrick, M. W., Jones, N. D. 1991. Structure of recombinant human rheumatoid arthritic synovial fluid phospholipase A 2 at 2.2Å resolution. Nature. 352:79-82[Medline].

  50. Li, B., Copp, L., Castelhano, A. L., Feng, R., Stahl, M., Yuan, Z., Krantz, A. 1994. Inactivation of a cytosolic phospholipase A2 by thiol-modifying reagents: cysteine residues as potential targets of phospholipase A 2. Biochemistry. 33:8594-8603[Medline].

  51. Hope, W. C., Chen, T., Morgan, D. W. 1993. Secretory phospholipase A2 inhibitors and calmodulin antagonists as inhibitors of cytosolic phospholipase A2. Agents Actions. 39:c39-c42.

  52. Ackermann, E. J., Conde-Frieboes,, Dennis, E. A. 1995. Inhibition of macrophage Ca2+-independent phospholipase A2 by bromoenol lactone and trifluoromethyl ketones. J. Biol. Chem. 270:445-450[Abstract/Free Full Text].

  53. Street, I. P., Lin, H. K., Laliberte, F., Ghomashchi, F., Wang, Z., Perrier, H., Tremblay, N. M., Huang, Z., Weech, P. K., Gelb, M. H. 1993. Slow- and tight-binding inhibitors of 85-kDa human phospholipase A2. Biochemistry. 32:5935-5940[Medline].

  54. Tojo, H., Ono, T., Okamoto, M. 1988. A pancreatic-type phospholipase A2 in rat gastric mucosa. Biochem. Biophys. Res. Commun. 151:1188-1193[Medline].

  55. Ishizaki, J., Ohara, O., Nakamura, E., Tamaki, M., Ono, T., Kanda, H., Okamoto, M. 1989. cDNA cloning and sequence determination of rat membrane-associated phospholipase A2. Biochem. Biophys. Res. Commun. 162:1030-1036[Medline].

  56. McCord, M., Chabot-Fletcher, M., Breton, J., Marshall, L. A. 1994. Human keratinocytes possess an sn-2 acylhydrolase that is biochemically similar to U937-derived 85-kDa phospholipase A2. J. Invest. Dermatol. 102:980-986[Medline].

  57. Forsbeck, K., Nilsson, K., Hansson, A., Skoglund, G., Ingelman-Sundberg, M. 1985. Phorbol ester-induced alteration of differentiation and proliferation in human hematopoietic tumor cell lines: relationship to the presence and subcellular distribution of protein kinase C. Cancer Res. 45:6194-6199[Medline].

  58. Yamashita, S., Ogawa, M., Abe, T., Yamashita, J., Sakamoto, K., Niwa, H., Yamamura, K. 1994. Group II phospholipase A2 in invasive gastric cancer cell line is induced by interleukin 6. Biochem. Biophys. Res. Commun. 198:878-884[Medline].

  59. Pfeilschifters, J., Schalkwijk, C., Briner, V. A., van den Bosch, H. 1993. Cytokine-stimulated secretion of group II phospholipase A2 by rat mesangial cells. J. Clin. Invest. 92:2516-2523.

  60. Oka, S., Arita, H. 1991. Inflammatory factors stimulate expression of group II phospholipase A2 in rat culture astrocytes. J. Biol. Chem. 266:9956-9960[Abstract/Free Full Text].

  61. Slotboom, A. J., H. M. Verheij, and G. H. de Haas. 1982. On the mechanism of phospholipase A2. In New Comprehensive Biochemistry. J. W. Hawthorne and G. B. Ansell, editors. Elsevier, Amsterdam. Vol. 4. 359–434.

  62. Ando, M., Furui, H., Suzuki, K., Taki, F., Takagi, K. 1992. Direct activation of phospholipase A2 by GTP-binding protein in human peripheral polymorphonuclear leukocytes. Biochem. Biophys. Res. Commun. 183:708-713[Medline].

  63. Bokoch, G. M., Gilman, A. G. 1984. Inhibition of receptor-mediated release of arachidonic acid by pertussis toxin. Cell. 39:301-308[Medline].


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 FASEB J.Home page
G.-E. Costin and V. J.