Rapid Communication

Cloning and mutational analysis of human malonyl-coenzyme A decarboxylase

Correspondence to: Jonathan C. Cohen

	ABSTRACT

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Malonyl coenzyme A (CoA) decarboxylase (E.C.4. 1.1.9) catalyzes the conversion of malonyl CoA to acetyl CoA. The metabolic role of malonyl CoA decarboxylase has not been fully defined, but deficiency of the enzyme has been associated with mild mental retardation, seizures, hypotonia, cardiomyopathy, vomiting, hypoglycemia, metabolic acidosis, and malonic aciduria. Here we report the isolation and sequencing of the human gene encoding malonyl CoA decarboxylase, and the identification of a mutation causing malonyl CoA decarboxylase deficiency. Human malonyl CoA decarboxylase cDNA sequences were identified by homology to the goose gene, and the intron/exon boundaries were determined by direct sequencing of a PAC clone containing the entire human gene. The 1479 basepair human cDNA is 70 percent identical to the goose sequence, and the intron/exon boundaries are completely conserved between the two species. The genetic mutation underlying malonyl CoA decarboxylase deficiency was determined in a patient with clinical features of this defect, malonic aciduria, and markedly reduced malonyl CoA decarboxylase activity.—Gao, J., L. Waber, M. J. Bennett, K. M. Gibson, and J. C. Cohen. Cloning and mutational analysis of human malonyl-coenzyme A decarboxylase. J. Lipid Res. 1999. 40: 178–182.

Supplementary key words: microbodies, mitochondria, frameshift mutation, metabolism, inborn errors

	INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Malonyl coenzyme A (CoA) decarboxylase (E.C.4.1.1.9) activity has been detected in extracts from a wide variety of animal (1) (2) (3) and bacterial cells (4). The enzyme catalyzes the conversion of malonyl CoA to acetyl CoA, but the metabolic role of this reaction has not been fully defined. In most animal tissues, malonyl CoA decarboxylase is located in mitochondria (5) (6) (7). Accordingly it has been suggested that malonyl CoA decarboxylase protects key mitochondrial enzymes such as pyruvate carboxylase and methylmalonyl-CoA mutase from inhibition by malonyl CoA (3) (5).

In humans, deficiency of malonyl CoA decarboxylase has been associated with mild mental retardation, seizures, hypotonia, cardiomyopathy, vomiting, hypoglycemia, metabolic acidosis, and malonic aciduria (8) (9) (10) (11) (12) (13). Treatment with a fat-restricted diet (12) (13) and with carnitine (13) has lead to improved general health in two patients. The human gene encoding the enzyme has not been cloned, however, and the molecular basis for malonyl CoA decarboxylase deficiency has not been determined. As a first step towards elucidating the metabolic function of malonyl CoA decarboxylase in humans, we cloned and sequenced the human gene encoding the enzyme. Here we report i) the genomic and complementary DNA sequences of the human malonyl CoA decarboxylase gene, and ii) a mutation in the gene in a new case of malonyl CoA decarboxylase deficiency. Inspection of the derived amino acid sequence of human malonyl CoA decarboxylase revealed sequence motifs that may have implications for the metabolic function of the enzyme.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Subjects
The proband was the firstborn son of unrelated parents, and was born at term after an unremarkable pregnancy (birth weight was 8 lb, 3 oz). Micropenis and hypotonia were noted at birth, and he remained in the hospital for 12 days after birth for poor respirations. At 10 months of age he was readmitted and was found to have malonic aciduria, hypertrophic cardiomyopathy, and renal dysplasia. His extended chromosomes were normal. Malonyl CoA decarboxylase activity in his primary cultured fibroblasts was less than ten percent of control values. During surgery to have a gastrostomy feeding tube placed, the patient had a cardiac arrest and could not be revived.

Assay of malonyl CoA decarboxylase in cultured fibroblasts
Malonyl CoA decarboxylase activity was assayed in fibroblasts from the patient and in control fibroblasts by following the release of ¹⁴CO₂ from [1,3-¹⁴C]malonyl CoA as described by Brown et al. (8).

cDNA analysis
A search of the Expressed Sequence Tags database (dbests) of the National Center for Biotechnology Information, Bethesda, MD, identified 22 human cDNA clones with homology to the goose malonyl CoA decarboxylase cDNA sequence (14). Oligonucleotides were derived from the human EST sequences ATCC#135110 and IMAGE Consortium cDNA clone #127540. RNA was prepared from a human liver cell line (huh7), and from primary fibroblasts from the patient, and reverse transcribed using SuperScript reverse transcriptase (Life Technologies, Gaithersburg, MD). Human cDNA corresponding to exons 2 through 5 was PCR amplified using oligonucleotides MCD8 (5' GGTT TACTGTCAGAGCTTGCTGTTC 3') and MCD4 (5' GGGTTC CTGAACCTAGAACG 3'), and sequenced using a standard cycle sequencing protocol (Protocol # 402078, Applied Biosystems Inc. Foster City, CA). Partial exon 1 sequence was obtained by 5' RACE (5' RACE System Version 2.0, Life Technologies, Gaithersburg, MD) but no transcripts corresponding to the full length goose sequence were identified.

Genomic DNA analysis
A human PAC clone containing the entire malonyl CoA decarboxylase gene was identified by PCR screening using oligonucleotides MCD3 (5' AGTTTTTTACAGGATGCACAGCCTC 3') and MCD4. PAC DNA was prepared using KB-100 columns (GenomeSystems, St. Louis, MO) and the sequences of exon 1 and the intron/exon boundaries were obtained by direct sequencing using oligonucleotides derived from the cDNA as primers.

Chromosomal localization
Oligonucleotides MCD3 and MCD4 were used to PCR amplify DNA from a mouse/human hybrid cell line (CY18) that contains human chromosome 16 (kindly provided by Dr. Roger Schultz, UT Southwestern Med. Ctr.), and from the YAC My772D12 (kindly provided by Dr. Norman Doggett, Los Alamos National Laboratory). Genomic DNA samples from mouse liver, and from a second mouse/human hybrid (A15) that does not contain human chromosome 16 sequences was used as negative controls.

Malonyl CoA decarboxylase expression
A cDNA for the human malonyl CoA decarboxylase was cloned into pCMV6 (kindly provided by Dr. David Russell at UT Southwestern Medical Center) and transiently transfected into in a human hepatoma (huh7) cell line. After 24 h the cells were lysed and the activity of the expressed enzyme was assayed by a carnitine acetyltransferase-linked assay as described by Antinozzi et al. (15).

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Malonyl CoA decarboxylase activity
Malonyl CoA decarboxylase activity in primary cultured fibroblasts from the patient was assayed on five separate occasions. On each occasion, the activity of the enzyme was less than 10% of the activity measured in fibroblasts from five normal patients. The activity of a control enzyme (mevalonate kinase) was similar in fibroblasts from the patient and in fibroblasts from the control subjects.

Malonyl CoA decarboxylase gene sequence
Direct sequencing of the PAC revealed two in-frame ATG sequences in exon 1 that are completely conserved between human and goose. The 1479 nucleotide open reading frame ( Figure 1) extending from the upstream ATG codon to the stop codon (TGA) in the human sequence is 70% identical to the homologous sequence in goose, and the intron/exon boundaries are completely conserved between the two species. The deduced amino acid sequence is 68% identical (82% similar) between the two species ( Figure 2). BLAST searches of GenBank and SwissProt indicated that the human and goose malonyl CoA decarboxylase enzymes do not have significant homology to other known proteins. Interestingly, a putative gene (F35G12.1) identified on a cosmid from the nematode C. elegans (GenBank Accession number Z46242) encodes a 360 amino acid protein with 44% sequence identity to the goose malonyl CoA decarboxylase protein.

View larger version (107K): [in this window] [in a new window]   Figure 1. Nucleotide and deduced amino acid sequence of the human malonyl coA decarboxylase gene. The ATG sequences corresponding to the translation initiation codons in the goose sequence, the c.638–641delGTGA mutation, and the peroxisomal targeting sequence are indicated in bold type. The sizes of introns 2, 3, and 4 were determined by PCR from the PAC, and confirmed by amplification from human genomic DNA. The size of intron 1 was estimated by Southern blotting of restriction-digested PAC DNA using oligonucleotide probes from exon 1 and exon 2.

View larger version (72K): [in this window] [in a new window]   Figure 2. Alignment of the deduced amino acid sequences of the human and goose malonyl coA decarboxylase proteins. The 18 amino acids that comprise the mitochondrial targeting sequence in the goose and the conserved canonical peroxisomal targeting sequence are indicated in bold type.

Sequencing of cDNA prepared from the patient's fibroblasts indicated that four nucleotides at the 3' end of exon 2 were deleted (c.638–641delGTGA, see Figure 1 and Figure 3). The resulting frame shift introduced a premature stop codon eight codons downstream of the deletion. The protein translated from the mutant mRNA would lack 272 carboxy terminal amino acids, therefore the mutation almost certainly abolishes malonyl CoA decarboxylase activity. The mutation was confirmed by direct sequencing of PCR amplified genomic DNA. No other mutations were identified in the coding region or in the intron exon boundaries of the gene. Genomic DNA sequencing indicated that both parents were heterozygotes for the c.638–641delGTGA mutation, therefore the patient is homozygous for this mutation.

View larger version (37K): [in this window] [in a new window]   Figure 3. Malonyl CoA decarboxylase cDNA sequence from a normal individual and a patient with malonyl CoA decarboxylase deficiency. The site of the deletion is indicated by an arrow in the mutant sequence. The deleted nucleotides are underlined in the normal sequence.

Chromosomal localization
A human EST (IMAGE clone #127540) with strong homology to goose malonyl CoA decarboxylase cDNA has been previously mapped to 331.9 cR. from the top of chromosome 16 linkage group (Unigene Collection, National Center for Biotechnology Information). To confirm this map position, DNA from a mouse/human hybrid cell line (CY18) containing human chromosome 16 and from megaYAC My772D12 was amplified by PCR. These results indicate that the human malonyl CoA decarboxylase gene lies in a ~450 kb interval between D16S402 and D16S422 on chromosome 16q24.

Malonyl CoA decarboxylase expression
Transfection of the human malonyl CoA decarboxylase cDNA into huh7 cells increased malonyl CoA decarboxylase activity by about 4-fold ( Figure 4).

View larger version (13K): [in this window] [in a new window]   Figure 4. Malonyl CoA decarboxylase activity in cultured cells. Huh7 cells were plated in 10-cm dishes and transfected with 10 µg of vector alone (pCMV6) as a negative control, or with 10 µg of pCMV6 containing the human malonyl CoA decarboxylase cDNA (pCMV6-MCD), or infected with 1010 µg of adenovirus containing the goose malonyl CoA decarboxylase (positive control). Transfected cells were incubated for 24 h, lysed, and assayed for malonyl CoA decarboxylase activity exactly as described (15).

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Malonyl CoA decarboxylase deficiency is a rare inborn error of metabolism (8) (9) (10) (11) (12). To elucidate the molecular basis of this condition we cloned the human gene encoding malonyl CoA decarboxylase, and sequenced genomic and complementary DNA from a patient with clinical and biochemical features consistent with the disorder. Analysis of complementary and genomic DNA indicated that human malonyl CoA decarboxylase is a 493 amino acid protein. Transfection of the cDNA into a human hepatoma cell line confirmed that this gene encodes a protein with malonyl CoA decarboxylase activity. The cDNA and deduced amino acid sequences are highly conserved (~70% identical) between human and goose, and the locations of the intron/exon boundaries are identical between the two species. Partial sequencing (1001 nucleotides) of the mouse malonyl CoA decarboxylase gene (J. C. Cohen, unpublished results) revealed 83% identity between the human and mouse cDNA sequences. The high degree of sequence identity between the malonyl CoA decarboxylase genes from these three species indicates strong evolutionary conservation.

DNA sequence from the proband revealed a four nucleotide deletion in the gene encoding malonyl CoA decarboxylase that introduced a premature stop codon and deleted the 272 carboxy terminal amino acids of the protein. This mutation almost certainly abolishes malonyl CoA decarboxylase activity. The same mutation was identified in both parents, therefore the proband is a true homozygote. The absence of any detectable chromosomal abnormality in the proband strongly indicates that his unusual phenotype was due entirely to malonyl CoA decarboxylase deficiency. Some of the clinical features observed in this individual and in previously described patients with malonyl CoA decarboxylase deficiency (e.g., seizures, hypotonia, cardiomyopathy), have also been observed in patients with mitochondrial disorders (see ref. 15 for review). Defective mitochondrial function may therefore account for some or all of the clinical sequelae of malonyl CoA decarboxylase deficiency.

Inspection of the derived amino acid sequence of human malonyl CoA decarboxylase revealed sequence motifs that may indicate alternative metabolic functions for the enzyme. In the goose, the mitochondrial and cytoplasmic forms of malonyl CoA decarboxylase are transcribed from alternate, in-frame initiation codons separated by 146 nucleotides in exon 1 (16). Transcripts from the upstream codon include an 18 amino acid N-terminal motif that forms an amphipathic alpha helix (16) constituting the mitochondrial targeting sequence. Both AUG codons are conserved in the human sequence, and both are in an appropriate sequence context for efficient initiation of translation as determined by Kozak (17). However, the putative mitochondrial targeting sequence identified in the goose protein is poorly conserved in humans (see Figure 2). Secondary structure modeling of the N-terminus of the human protein (using the computer program Protean, DNAstar) suggests that this region does not form an amphipathic alpha helix and does not correspond to a canonical mitochondrial targeting sequence. Therefore further studies will be required to determine whether malonyl CoA decarboxylase is a mitochondrial enzyme in humans, and the extent to which the phenotype of malonyl CoA decarboxylase deficiency reflects impaired mitochondrial function. Interestingly, a canonical peroxisomal-matrix targeting sequence (SKL) at the carboxy terminus of the protein (18) is strictly conserved in human, goose, and mouse (J. C. Cohen, unpublished results). This sequence is sufficient to direct some (though not all) carrier proteins to peroxisomes (18). Therefore the human malonyl CoA decarboxylase may be targeted to peroxisomes in addition to (or possibly instead of) mitochondria.

	ACKNOWLEDGMENTS

We thank Sijing Niu and Liangcai Nie for excellent technical assistance, and Peter Antinozzi for assistance with the malonyl CoA decarboxylase assay in huh7 cells. This work was supported by NIH grant HL53917.

Manuscript received September 29, 1998; and in revised form October 28, 1998.

	REFERENCES

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

1. Kim, Y. S., Kolattukudy, P. E. 1978. Malonyl-CoA decarboxylase from the mammary gland of lactating rat. Purification, properties and subcellular localization. Biochim. Biophys. Acta. 531:187-196[Medline].

2. Kim, Y. S., Kolattukudy, P. E. 1978. Malonyl-CoA decarboxylase from the uropygial gland of waterfowl: purification, properties, immunological comparison, and role in regulating the synthesis of multimethyl-branched fatty acids. Arch. Biochem. Biophys. 190:585-597[Medline].

3. Kim, Y. S., Kolattukudy, P. E. 1978. Purification and properties of malonyl-CoA decarboxylase from rat liver mitochondria and its immunological comparison with the enzymes from rat brain, heart, and mammary gland. Arch. Biochem. Biophys. 190:234-246[Medline].

4. Kim, Y. S., Kolattukudy, P. E., Boos, A. 1979. Malonyl-CoA decarboxylase from. Mycobacterium tuberculosis and(Pseudomonas fluorescens. Arch. Biochem. Biophys. 196):543-551.

5. Scholte, H. R. 1969. The intracellular and intramitochondrial distribution of malonyl-CoA decarboxylase and propionyl-CoA carboxylase in rat liver. Biochim. Biophys. Acta. 178:137-144[Medline].

6. Kim, Y. S., Kolattukudy, P. E., Boos, A. 1979. Dual sites of occurrence of malonyl-CoA decarboxylase and their possible functional significance in avian tissues. Comp. Biochem. Physiol. [B.]. 62:443-447[Medline].

7. Kim, Y. S., Kolattukudy, P. E., Boos, A. 1979. Malonyl-CoA decarboxylase in rat brain mitochondria. Int. J. Biochem. 10:551-555[Medline].

8. Brown, G. K., Scholem, R. D., Bankier, A., Danks, D. M. 1984. Malonyl coenzyme A decarboxylase deficiency. J. Inherit. Metab. Dis. 7:21-26[Medline].

9. Haan, E. A., Scholem, R. D., Croll, H. B., Brown, G. K. 1986. Malonyl coenzyme A decarboxylase deficiency. Clinical and biochemical findings in a second child with a more severe enzyme defect. Eur. J. Pediatr. 144:567-570[Medline].

10. MacPhee, G. B., Logan, R. W., Mitchell, J. S., Howells, D. W., Tsotsis, E., Thorburn, D. R. 1993. Malonyl coenzyme A decarboxylase deficiency. Arch. Dis. Child. 69:433-436[Abstract].

11. Matalon, R., Michaels, K., Kaul, R., Whitman, V., Rodriguez-Novo, J., Goodman, S., Thorburn, D. 1993. Malonic aciduria and cardiomyopathy. J. Inherit. Metab. Dis. 16:571-573[Medline].

12. Krawinkel, M. B., Oldigs, H. D., Santer, R., Lehnert, W., Wendel, U., Schaub, J. 1994. Association of malonyl-CoA decarboxylase deficiency and heterozygote state for haemoglobin C disease. J. Inherit. Metab. Dis. 17:636-637[Medline].

13. Yano, S., Sweetman, L., Thorburn, D. R., Mofidi, S., Williams, J. C. 1997. A new case of malonyl coenzyme A decarboxylase deficiency presenting with cardiomyopathy. Eur. J. Pediatr. 156:382-383[Medline].

14. Jang, S. H., Cheesbrough, T. M., Kolattukudy, P. E. 1989. Molecular cloning, nucleotide sequence, and tissue distribution of malonyl-CoA decarboxylase. J. Biol. Chem. 264:3500-3505[Abstract/Free Full Text].

15. Antinozzi, P. A., Segall, L., Prentki, M., McGarry, J. D., Newgard, C. B. 1998. Molecular or pharmacologic perturbation of the link between glucose and lipid metabolism is without effect on glucose-stimulated insulin secretion. A re-evaluation of the long-chain acyl-CoA hypothesis. J. Biol. Chem. 273:16146-16154[Abstract/Free Full Text].

16. Courchesne-Smith, C., Jang, S. H., Shi, Q., DeWille, J., Sasaki, G., Kolattukudy, P. E. 1992. Cytoplasmic accumulation of a normally mitochondrial malonyl-CoA decarboxylase by the use of an alternate transcription start site. Arch. Biochem. Biophys. 298:576-586[Medline].

17. Kozak, M. 1996. Interpreting cDNA sequences: some insights from studies on translation. Mamm. Genome. 7:563-574[Medline].

18. McNew, J. A., Goodman, J. M. 1996. The targeting and assembly of peroxisomal proteins: some old rules do not apply. Trends Biochem. Sci. 21:54-58[Medline].