J. Lipid Res.  Neurobiology of Lipids (ISSN1683-5506)
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weng, W.
Right arrow Articles by Breslow, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weng, W.
Right arrow Articles by Breslow, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Journal of Lipid Research, Vol. 40, 1064-1070, June 1999
Copyright © 1999 by Lipid Research, Inc.


Original Article

ApoA-II maintains HDL levels in part by inhibition of hepatic lipase: studies in apoA-II and hepatic lipase double knockout mice

Wei Wenga, Neal A. Brandenburga, Shaobin Zhongb, Joanna Halkiasa, Lin Wua, Xian-cheng Jiangb, Alan Tallb, and Jan L. Breslowa
a Laboratory of Biochemical Genetics and Metabolism, The Rockefeller University, 1230 York Avenue, New York, NY 10021
b Division of Molecular Medicine, Department of Medicine, Columbia University, New York, NY 10032

Correspondence to: Jan L. Breslow


  ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODs
RESULTS
DISCUSSION
REFERENCES

High density lipoprotein (HDL) cholesterol levels are inversely related to the risk of developing coronary heart disease. Apolipoprotein (apo) A-II is the second most abundant HDL apolipoprotein and apoA-II knockout mice show a 70% reduction in HDL cholesterol levels. There is also evidence, using human apoA-II transgenic mice, that apoA-II can prevent hepatic lipase-mediated HDL triglyceride hydrolysis and reduction in HDL size. These observations suggest the hypothesis that apoA-II maintains HDL levels, at least in part, by inhibiting hepatic lipase. To evaluate this, apoA-II knockout mice were crossbred with hepatic lipase knockout mice. Compared to apoA-II-deficient mice, in double knockout mice there were increased HDL cholesterol levels (57% in males and 60% in females), increased HDL size, and decreased HDL cholesteryl ester fractional catabolic rate. In vitro incubation studies of plasma from apoA-II knockout mice, which contains largely apoA-I HDL particles, showed active lipolysis of HDL triglyceride, whereas similar studies of plasma from apoA-I knockout mice, which contains largely apoA-II particles, did not..

In summary, these results strongly suggest that apoA-II is a physiological inhibitor of hepatic lipase and that this is at least part of the mechanism whereby apoA-II maintains HDL cholesterol levels.—Weng, W., N. A. Brandenburg, S. Zhong, J. Halkias, L. Wu, X-c. Jiang, A. Tall, and J. L. Breslow. ApoA-II maintains HDL levels in part by inhibition of hepatic lipase: studies in apoA-II and hepatic lipase double knockout mice. J. Lipid Res. 1999. 40: 1064–1070.

Supplementary key words: apoA-II , apoA-I , hepatic lipase , HDL cholesterol


  INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODs
RESULTS
DISCUSSION
REFERENCES

High density lipoprotein (HDL) cholesterol levels are inversely correlated with coronary heart disease susceptibility within populations (1) (2) (3) (4). HDL is a macromolecular complex consisting of approximately 50% lipid, mainly phospholipid and cholesteryl ester, and 50% protein, of which apoA-I accounts for 70% and apoA-II 20% of protein mass (5). Mature HDL particles are formed in plasma. Nascent HDL consists of protein phospholipid discs that are derived from liver and intestine (5) (6) (7). These combine with free cholesterol from cell membranes and other lipoproteins. The free cholesterol is esterified by lecithin:cholesterol acyltransferase (LCAT). The more hydrophobic cholesteryl ester changes the shape of the particle to spherical and resides in the core with protein, phospholipid, and free cholesterol on the HDL surface. Triglyceride from very low density (VLDL) and intermediate density lipoproteins (IDL) can exchange with HDL cholesteryl ester via cholesteryl ester transfer protein (CETP). Lipoprotein lipase (LPL)-mediated lipolysis of triglyceride-rich lipoproteins can provide surface components that can transfer to HDL, enlarging the particles, and hepatic lipase (HL) can act as an HDL triglyceride lipase and phospholipase, diminishing HDL size. Various metabolic studies in humans and mice have shown a strong inverse correlation between HDL size and fractional catabolic rate (8) (9).

In previous studies of apoA-II function using transgenic mice, Zhong et al. (10) showed that expression of a human apoA-II transgene did not prevent the reduction of HDL cholesterol mediated by CETP, but did result in enhanced CETP-mediated accumulation of triglyceride in HDL. The presence of the human apoA-II transgene also inhibited the normal CETP-mediated reduction in HDL size, and HDL containing human apoA-II inhibited HL in an emulsion-based assay and resisted the endogenous HL activity in mouse plasma. This was interpreted to mean that apoA-II does not inhibit CETP-mediated cholesteryl ester–triglyceride exchange, but does inhibit the hydrolysis of HDL triglyceride and phospholipid by HL. ApoA-II knockout mice were created and found to have a marked reduction of HDL cholesterol levels and size (9). This suggested that in the absence of apoA-II there may be unopposed and therefore overactive HL activity which, by diminishing the HDL phospholipid pool, could decrease HDL by affecting synthesis or clearance of HDL particles.

In the current report we further explored the hypothesis that apoA-II maintains HDL levels by inhibiting HL by studying apoA-II and HL double knockout mice. We reasoned that if apoA-II deficiency lowered HDL levels by an HL- dependent mechanism, then HDL levels should be restored in mice deficient in both apoA-II and HL. Compared to apoA-II-deficient mice, we found considerable restoration of HDL levels, increased HDL size, and decreased HDL fractional catabolic rate in double knockout mice, supporting our hypothesis.


  METHODs
TOP
ABSTRACT
INTRODUCTION
METHODs
RESULTS
DISCUSSION
REFERENCES

Generation of apoA-II and HL double knockout mice
ApoA-II knockout mice were generated at Rockefeller University (9) and HL knockout mice were generated by Homanics et al. (11). Heterozygous apoA-II knockout mice (50% C57Bl/6J and 50% 129/Ola) were bred to produce wild-type controls and homozygous apoA-II knockout mice. Homozygous apoA-II knockout mice and homozygous HL knockout mice (on the C57Bl/6J background, Jackson Laboratory) were crossbred. Doubly heterozygous knockout mice were backcrossed to homozygous apoA-II knockout mice to generate heterozygous HL knockout mice on the background of homozygosity for the apoA-II knockout. These mice were then intercrossed to generate apoA-II knockout and apoA-II, HL double knockouts, which were then directly compared. Comparisons were done on littermate mice that were between 4 and 5 months of age at the time of study.

DNA was isolated from the tail tips and PCR-based assays were used to identify the wild-type and mutant alleles in the colony. The PCR assay used to identify apoA-II knockout alleles was described in our previous paper (9). The PCR assay used to identify the wild-type HL allele used primer pairs HL7us, located at the beginning of the HL gene 4th exon with a sequence of 5'-GA ATCTGCGAAGTTTTCTCGGAG -3', and HL6ls, located at the end of the 4th exon with a sequence of 5'-CCTGTGATTCTTCCA ATCTTGTTC-3' and produced a band of 0.12 kb. The PCR used to identify the mutant allele used primer HL7us, as above, and primer 3094, located in the end portion of the neo gene cassette with a sequence of 5'-GACTGTGGCCGGCTGGGTGTGGCGGA CCGC-3'. With these primers the mutant allele gave a PCR fragment of 0.3 kb.

Animal maintenance
Animals were housed at the Rockefeller University Laboratory Animal Research Center (LARC). The animal room was maintained on 12 h (7 AM to 7 PM) light/dark cycles. Animals were fed a low fat–low cholesterol diet (chow diet) (no. 5001; Ralston Purina. The chow diet contained (wt/wt) 4.5% fat, 59.8% carbohydrate, 23.4% protein, 5.0% fiber, 7.3% minerals, and 0.02% cholesterol. In this diet fat provided 9% of calories, which were divided equally among saturated, monounsaturated, and polyunsaturated fats.

Plasma lipid and lipoprotein analysis
Blood was drawn from the retroorbital venous plexus into EDTA tubes. Fasting specimens were used and for these food was removed from the cages at 9 AM and the animals were bled between 4 and 5 PM. Cholesterol and triglyceride levels were determined enzymatically using Boehringer Mannheim reagents. The distribution of cholesterol among the lipoprotein size classes was analyzed by fast protein liquid chromatography (FPLC). For this analysis, 500 µl of pooled mouse plasma was first filtered through a 0.45-µM filter and then passed through two Superose 6 columns connected in series (Pharmacia). Forty-five fractions of 0.5 ml each were collected and assayed as above for cholesterol. Mouse plasma was also subjected to sequential preparative ultracentrifugation to determine lipoprotein cholesterol concentrations as previously described.

Lipoprotein size analysis
HDL particle size distribution was determined by 4 –20% non-denaturing gradient gel electrophoresis (12) (13). The HDL isolated by preparative ultracentrifugation was electrophoresed for 20 min at 70 V and then overnight at 150 V. The gel was then stained with 0.05% Coomassie blue and destained with 9% acetic acid and 20% methanol. HDL particle size was judged in comparison to the size of known protein standards (high molecular weight calibration kit; Pharmacia). Human HDL subpopulations and particle diameters determined by this technique are as follows: HDL2b, 12.9–9.8 nm; HDL2a, 9.8–8.8 nm; HDL3a, 8.8–8.2 nm; HDL3b, 8.2–7.8 nm; and HDL3c, 7.8–7.2 nm. To avoid the manipulation of ultracentrifugation, we also developed a method to run plasma on a native polyacrylamide gel as above and detect HDL by immunoblotting. To do this the polyacrylamide gel was blotted onto PVDF membranes (DuPont), which were then probed with goat anti-mouse apoA-I antibody at a dilution of 1:3000 (plasma:PBS). The location of apoA-I on the blot was detected by staining with peroxidase-labeled rabbit anti-goat IgG antibodies followed by a chemiluminescence reaction (ECL kit, Amersham).

HDL turnover study
The cholesteryl ester in HDL was radiolabeled as [3H]cholesteryl oleoyl ether as follows: 10 µCi (1 Ci = 37 GBq) of [3H]cholesteryl oleoyl ether was dried under nitrogen gas for 20 sec. Subsequently, 1 ml of 0.9% NaCl and 1.5 µl of 10–20% intralipid (KabiVitrum, Stockholm) were added. After sonication, 500 µl of plasma from control mice was added with 2.0 µg of purified human CETP. The mixture was incubated for 8 h at 37 °C, and radiolabeled HDL was then isolated by preparative ultracentrifugation. HDL turnover was done by injecting 100,000–200,000 dpm of 3H-labeled HDL. Serial blood samples were obtained from the retroorbital plexus at 10 and 90 min and 3, 8, and 24 h. HDL cholesteryl ester fractional catabolic rates were calculated by the Matthew's two pool model (12).

Hepatic lipase activity determinations
Heparin (100 U/kg body wt; Elkins-Sinn, Inc., Cherry Hill, NJ) was injected into the leg vein of apoA-I and apoA-II knockout mice and wild-type littermate controls under isoflurane anesthesia. Post-heparin plasma was collected after 5 min. Hepatic lipase activity in post-heparin plasma (10 µl) was measured using a gum arabic-stabilized emulsion containing 0.88 M NaCl to inactivate lipoprotein lipase. To assess the effects of HDL isolated from mice of different genotypes on hepatic lipase activity, 0–50 µg of dialyzed mouse HDL was added to 300 µl of a gum arabic-stabilized emulsion, pH 8.8, in 1.25 M NaCl prepared by the method of Baginsky and Brown (13). The assay was begun by addition of 10 µl of mouse post-heparin plasma (from wild-type mice) and allowed to continue for 1 h at 27 °C. The reaction was terminated by addition of 3.5 ml of a solution of methanol–chloroform–heptane–oleic acid 1,410:1,250:1,000:1,000 (vol:vol) and 1 ml of 0.05 M potassium borate buffer, pH 10. After centrifugation, 1 ml of the aqueous phase was removed, 3.5 ml of Hydrofluor (National Diagnostics, Manville, NJ) was added, and the amount of liberated free fatty acids was determined by liquid scintillation spectroscopy in a beta counter (LS 1000; Beckman Instruments). All assays were performed in triplicate and the experiment was performed twice using different pooled preparations of HDL from mice of each genotype.

Plasma HDL cholesterol and triglyceride determinations after in vitro incubation with rCETP and diethyl p -nitrophenylphosphate (E600)
Plasma was obtained from apoA-I and apoA-II knockout, and wild-type littermate controls. An aliquot (200 µl) of such pooled plasma was immediately stored on ice. At the same time, two other aliquots (200 µl each) were incubated with purified human CETP (20 µg/ml), with or without E600 (500 µM) for 5 h. Plasma HDL was subsequently isolated by ultracentrifugation between densities 1.055 and 1.21 g/ml and cholesterol and triglyceride were determined.

Statistical analysis
Results are given as mean ± SD unless otherwise indicated. The Student's t -test was used to compare differences between groups. Statistical significance was defined as P < 0.05.


  RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODs
RESULTS
DISCUSSION
REFERENCES

ApoA-II and HL knockout mice and the double knockout mice all appeared healthy without any gross phenotypic abnormality, and gained weight normally (data not shown). As shown in Table 1, compared to wild-type mice the apoA-II knockout mice had reduced total, HDL, and non-HDL cholesterol levels, as previously shown (9). Compared to the apoA-II knockout mice, in the apoA-II, HL double knockout mice HDL cholesterol levels increased 57% and 60% in males and females, respectively. The percent restoration of wild-type HDL cholesterol levels was greater in females than males, due to higher HDL cholesterol levels in wild-type male compared to female mice. These results using preparative ultracentrifugation were confirmed by FPLC analysis as shown in Figure 1a and Figure b.




View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. FPLC fractionation of plasma from apoA-II knockout, double knockout, and wild-type mice on chow diet. Two hundred µl of fasted, pooled, and filtered mouse plasma was applied to two Superose 6 columns (Phamacia) connected in series. The lipoproteins were eluted at a constant flow rate of 0.3 ml/min with 1 mM sodium EDTA and 0.15 M NaCl. Fractions of 0.5 ml were collected and cholesterol concentrations were measured enzymatically. Cholesterol values are shown as mg/dl in each fraction; A, males; B, females.


 
View this table:
[in this window]
[in a new window]
 
Table 1. Plasma cholesterol level under fasting conditions from apoA-II knockout and double knockout mice, and wild-type mice on chow

The size distribution of lipoprotein particles in mice with the various genotypes was next examined by two techniques. In the first, HDL was isolated by subsequential preparative ultracentrifugation and subjected to non-denaturing gradient gel electrophoresis. As shown in Figure 2a, the mean particle diameter of HDL in wild-type mice was 9.7 nm, in apoA-II knockouts it was 8.9 nm, and in the apoA-II HL double knockouts it was 9.5 nm. Thus the lack of apoA-II results in smaller HDL, and this is restored when HL is also deficient. HDL size was also determined by non-denaturing PAGE using immunoblotting of whole plasma. This avoids possible artifacts that might be introduced by ultracentrifugation, which can spin off some HDL components. The results shown in Figure 2b were quite similar to those using the first technique. HDL size was reduced in the apoA-II knockout mice and size largely returned to normal in the double knockout mice.




View larger version (109K):
[in this window]
[in a new window]
 
Figure 2. The distribution of HDL particle size diameters. AII0HL2, AII0HL0, and AII2HL2 represent apoA-II knockout, double knockout, and wild-type control mice, respectively. A: HDL was isolated by sequential ultracentrifugation and HDL from an equal amount of plasma was subjected to non-denaturing gradient gel electrophoresis (4 –16% gradient). The gel was then stained and scanned by LKB Laser Densitomerlittermates. B: equal amounts of plasma were subjected to non-denaturing gradient gel electrophoresis (4 –16% gradient). The gel was transferred and apoA-I was identified by chemiluminescence reaction.

The metabolic mechanism underlying the changes observed in HDL cholesterol levels was also studied. As shown in Table 2, compared with the apoA-II knockout mice, in the apoA-II HL double knockout mice there was a 67% decrease in HDL cholesteryl ester fractional catabolic rate with no change in transport rate. The increased HDL cholesteryl ester fractional catabolic rate in the apoA-II knockout mice was decreased to nearly normal in the double knockout mice. Thus the partial restoration of HDL cholesterol levels in the double knockout mice is entirely due to changes in the fractional catabolic rate.


 
View this table:
[in this window]
[in a new window]
 
Table 2. HDL cholesterol metabolism in apoA-II knockout, double knockout, and wild-type nonfasted mice, respectively

The data thus far are compatible with the hypothesis that the lack of apoA-II results in increased functional HL activity and that HL by its ability to hydrolyze HDL triglyceride and phospholipid diminishes HDL size, causing increased HDL fractional catabolic rate. To measure the effect of apoA-II deficiency on functional HL activity, plasma samples from wild-type, apoA-I, and apoA-II-deficient mice were incubated with rCETP with and without a lipase inhibitor (E600), HDL was isolated, and HDL triglycerides and cholesterol were measured. In all cases incubation resulted in increased HDL triglycerides; however, as shown in Figure 3, in the presence of apoA-II (apoA-I knockout mice) the HL inhibitor did not further increase HDL triglycerides, whereas in the presence of apoA-I (apoA-II knockout mice) the HL inhibitor substantially further increased HDL triglyceride levels. The HL inhibitor had no effect on HDL cholesterol levels as expected (not shown). This experiment provides further evidence that apoA-II can serve as a functional inhibitor of HL activity, comparable to exogenously added E600.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. The difference in plasma HDL triglyceride contents before and after incubation with rCETP and diethyl p -nitrophenylphosphate. Two hundred µl pooled plasma was incubated with rCETP (20 µg/ml plasma) and E600 (500 µM). HDL with and without the rCETP and E6000 incubation was then isolated by ultracentrifugation between densities 1.055 and 1.21 g/ml. Triglyceride was determined by enzymatic reaction (Wako Bioproducts). The difference in plasma HDL triglyceride contents before and after the rCETP and E6000 incubation is shown; a and b are significantly different from each other at P < 0.01.


  DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODs
RESULTS
DISCUSSION
REFERENCES

In the current study, apoA-II and HL double knockout mice were generated to explore the mechanism whereby apoA-II regulates HDL cholesterol levels. Based on published studies with HL knockout mice (11), if there were no interaction between apoA-II and hepatic lipase, double knockouts would have had only a 10–15% increase in HDL cholesterol compared to apoA-II knockout mice rather than the 60% increase observed. Compared with apoA-II deficient mice, mice deficient in both apoA-II and HL had increased HDL size and decreased HDL cholesteryl ester fractional catabolic rate restoring both to near normal levels. In vitro biochemical assays also demonstrated functional inhibition of HL HDL triglyceride hydrolysis in apoA-II but not apoA-I containing HDL. These studies strongly suggest that apoA-II is a physiological inhibitor of HL and that apoA-II maintains HDL cholesterol levels at least in part by inhibition of HL activity. Our studies do not elucidate whether this reflects a direct interaction of apoA-II with HL, or whether apoA-II changes HDL structure and thereby indirectly influences HL activity. Another caveat in extending our studies to humans is that human HL is more than 90% in liver, whereas mouse HL is 80% in plasma. Thus there may be important species differences in apoA-II–HL interaction.

In a previous study, we showed that apoA-II knockout mice had severely diminished HDL cholesterol levels, demonstrating that mouse apoA-II plays an important role in maintaining the plasma HDL pool (9). The exact mechanism underlying this observation was uncertain. One possibility was that apoA-II acted solely as a major structural protein of HDL. However, another possibility was that apoA-II acted as a physiological inhibitor of HL, and that increased functional HL activity decreased HDL cholesterol levels in the apoA-II-deficient mice. The latter possibility gains favor from the current double knockout studies, from various studies in vivo implicating HL as a major regulator of HDL cholesterol levels, and from some in vitro studies demonstrating apoA-II interactions with HL.

In clinical studies it has repeatedly been shown that there is an inverse relationship between heparin-releasable hepatic lipase activity and HDL cholesterol levels (14) (15) (16) (17). A sib pair analysis indicates a role for the HL gene in regulation of HDL cholesterol levels and there is an association of an HL gene promoter polymorphism and HDL cholesterol levels (18). In transgenic mice (19) and rabbits (20) the human HL transgene lowered HDL cholesterol levels, and HL knockout mice (11) and HL-deficient humans (21) (22) (23) have mildly increased HDL cholesterol levels.

ApoA-II HL interactions have been demonstrated in many in vitro studies. Using a surface monolayer model, Thuren et al. (24) showed that apoA-II inhibits both the penetration of HL into a phospholipid monolayer and the triglyceride hydrolase activity of HL within the monolayer (24). Hime, Barter, and Rye (25) recently showed, using recombinant HDL particles with either apoA-I or apoA-II, that HL has a higher affinity but a much lower maximum rate of hydrolysis for HDL phospholipids and triglyceride for recombinant apoA-II HDL compared to recombinant apoA-I HDL. In another study, Jahn et al. (26) showed that isolated apoA-II could act either as a stimulator or inhibitor of HL depending on assay condition. A number of other in vitro studies have suggested that apoA-II might stimulate the hydrolysis of HDL triglyceride (27) (28) (29). Thus it is clear that apoA-II and HL can interact but the role of apoA-II as a physiological inhibitor was affirmed using human apoA-II transgenic mice. In this study in vivo apoA-II prevented HL-mediated HDL triglyceride hydrolysis and reduction in HDL size. In vitro HDL containing human apoA-II inhibited hepatic lipase activity in an emulsion-based assay and resisted the endogenous hepatic lipase activity in mouse plasma (10). In a similar type of assay in the current paper, we showed strong inhibition of HL triglyceride lipase activity in apoA-II but not in apoA-I-containing HDL. These results also support the hypothesis that apoA-II maintains the plasma HDL pool by inhibiting HL.

In this study wild-type female mice were found to have lower HDL cholesterol levels than males. However, in the apoA-II knockout and the apoA-II HL double knockout mice, the male–female difference disappears. This implies that the difference in HDL cholesterol levels between wild-type female and male mice is due to apoA-II or the apoA-II–HL interaction. Sex hormone effects on HL levels and activity have been well documented with androgens increasing HL (30) (31) and estrogens, in some species, decreasing HL (32) (33). There are also some sex hormone effects on apoA-II expression (34) (35).

HDL cholesterol levels were almost completely restored in the double knockout mice. The failure to completely restore levels may have been due to effects of the apoA-II knockout on apoA-I levels. A previous study showed that apoA-II knockout mice had a 45% reduction in apoA-I transport rate (9). Although we did not do apoA-I turnovers in the current experiments, it is probable that this also occurs in the double knockout mice and accounts for the failure to fully restore HDL cholesterol levels to normal.

In summary, utilizing induced mutant mice, we have shown that the severe reduction in HDL cholesterol levels in the apoA-II knockout mouse can be restored almost fully in female and partially in male mice by HL deficiency. These results suggest that the interaction between apoA-II and HL is important to maintaining the plasma HDL pool. It also suggests that postheparin HL activity may differ from functional HL activity, and that the latter may be regulated by the concentration of apoA-II in plasma or in specific HDL particles.


  ACKNOWLEDGMENTS

This manuscript was supported by Grants HL 33714 and HL 54591 from the National Institutes of Health.

Manuscript received September 30, 1998; and in revised form February 23, 1999.

Abbreviations: HDL, high density lipoproteins; LCAT, lecithin:cholesterol acyltransferase; VLDL, very low density lipoproteins; IDL, intermediate density lipoproteins; CETP, cholesteryl ester transfer protein; LPL, lipoprotein lipase; HL, hepatic lipase; FCR, fractional catabolic rate; TR, transport rate; CE, cholesteryl ester


  REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODs
RESULTS
DISCUSSION
REFERENCES

  1. Miller, N. E. 1987. Associations of high-density lipoprotein subclasses and apolipoproteins with ischemic heart disease and coronary atherosclerosis. Am. Heart J. 113:589-597[Medline].

  2. Castelli, W. P., Garrison, R. J., Wilson, P. W. F., Abbott, R. D., Kalousdian, S., Kannel, W. B. 1986. Incidence of coronary heart disease and lipoprotein cholesterol levels. The Framingham Study. J. Am. Med. Assoc. 256:2835-2838[Abstract].

  3. Gordon, T., Castelli, W. P., Hjortland, M. C., Kannel, W. B., Dawber, T. R. 1977. High density lipoprotein as a protective factor against coronary heart disease. The Framingham Study. Am. J. Med. 62:707-714[Medline].

  4. Gordon, D. J., Probstfield, J. L., Garrison, R. J., Neaton, J. D., Castelli, W. P., Knoke, J. D., Jacobs, D. R., Jr., Bangdiwala, S., Tyroler, H. A. 1989. High-density lipoprotein cholesterol and cardiovascular disease. Four prospective American studies. Circulation. 79:8-15[Abstract/Free Full Text].

  5. Eisenberg, S. 1984. High density lipoprotein metabolism. J. Lipid Res. 25:1017-1058[Medline].

  6. Tall, A. R. 1990. Plasma high density lipoproteins. Metabolism and relationship to atherogenesis. J. Clin. Invest. 86:379-384.

  7. Breslow, J. L. 1995. Disorders of HDL metabolism. In The Metabolic Basis of Inherited Disease. C. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle, editors. McGraw-Hill, New York. 2031–2052.

  8. Brinton, E. A., Eisenberg, S., Breslow, J. L. 1994. Human HDL cholesterol levels are determined by apoA-I fractional catabolic rate, which correlates inversely with estimates of HDL particle size. Effects of gender, hepatic and lipoprotein lipases, triglyceride and insulin levels, and body fat distribution. Arterioscler. Thromb. 14:707-720[Abstract/Free Full Text].

  9. Weng, W., Breslow, J. L. 1996. Dramatically decreased high density lipoprotein cholesterol, increased remnant clearance, and insulin hypersensitivity in apolipoprotein A-II knockout mice suggest a complex role for apolipoprotein A-II in atherosclerosis susceptibility. Proc. Natl. Acad. Sci. USA. 93:14788-14794[Abstract/Free Full Text].

  10. Zhong, S. B., Goldberg, I. J., Bruce, C., Rubin, E. M., Breslow, J. L., Tall, A. R. 1994. Human apoA-II inhibits the hydrolysis of HDL triglyceride and the decrease of HDL size induced by hypertriglyceridemia and cholesteryl ester transfer protein in transgenic mice. J. Clin. Invest. 94:2457-2467.

  11. Homanics, G. E., de Silva, H. V., Osada, J., Zhang, S. H., Wong, H., Borensztajn, J., Maeda, N. 1995. Mild dyslipidemia in mice following targeted inactivation of the hepatic lipase gene. J. Biol. Chem. 270:2974-2980[Abstract/Free Full Text].

  12. Matthews, C. 1957. The theory of tracer experiments with 131I-labeled plasma proteins. Phys. Med. Biol. 2:36-53[Medline].

  13. Baginsky, M. L., Brown, M. V. 1979. A new method for the measurement of lipoprotein lipase in postheparin plasma using sodium dodecyl sulfate for the inactivation of hepatic triglyceride lipase. J. Lipid Res. 20:548-556[Abstract].

  14. Kuusi, T., Saarinen, P., Nikkila, E. A. 1980. Evidence for the role of hepatic endothelial lipase in the metabolism of plasma high density lipoprotein2 in man. Atherosclerosis. 36:589-593[Medline].

  15. Applebaum-Bowden, D., Haffner, S. M., Wahl, P. W., Hoover, J. J., Warnick, G. R., Albers, J. J., Hazzard, W. R. 1985. Postheparin plasma triglyceride lipases. Relationships with very low density lipoprotein triglyceride and high density lipoprotein2 cholesterol. Arteriosclerosis. 5:273-282[Abstract/Free Full Text].

  16. Jackson, R. L., Yates, M. T., McNerney, C. A., Kashyap, M. L. 1990. Relationship between post-heparin plasma lipases, triglycerides and high density lipoproteins in normal subjects. Horm. Metab. Res. 22:289-294[Medline].

  17. Blades, B., Vega, G. L., Grundy, S. M. 1993. Activities of lipoprotein lipase and hepatic triglyceride lipase in postheparin plasma of patients with low concentrations of HDL cholesterol. Arterioscler. Thromb. 13:1227-1235[Abstract/Free Full Text].

  18. Guerra, R., Wang, J., Grundy, S. M., Cohen, J. C. 1997. A hepatic lipase (LIPC) allele associated with high plasma concentrations of high density lipoprotein cholesterol. Proc. Natl. Acad. Sci. USA. 94:4532-4537[Abstract/Free Full Text].

  19. Busch, S. J., Barnhart, R. L., Martin, G. A., Fitzgerald, M. C., Yates, M. T., Mao, S. J. T., Thomas, C. E., Jackson, R. L. 1994. Human hepatic triglyceride lipase expression reduces high density lipoprotein and aortic cholesterol in cholesterol-fed transgenic mice. J. Biol. Chem. 269:16376-16382[Abstract/Free Full Text].

  20. Fan, J., Wang, J., Bensadoun, A., Lauer, S. J., Dang, Q., Mahley, R. W., Taylor, J. M. 1994. Overexpression of hepatic lipase in transgenic rabbits leads to a marked reduction of plasma high density lipoproteins and intermediate density lipoproteins. Proc. Natl. Acad. Sci. USA. 91:8724-8728[Abstract/Free Full Text].

  21. Breckenridge, W. C., Little, J. A., Alaupovic, P., Wang, C. S., Kuksis, A., Kakis, G., Lindgren, F., Gardiner, G. 1982. Lipoprotein abnormalities associated with a familial deficiency of hepatic lipase. Atherosclerosis. 45:161-179[Medline].

  22. Carlson, L. A., Homnquist, L., Nilsson-Ehle, P. 1986. Deficiency of hepatic lipase activity in post-heparin plasma in familial hyper-alpha-triglyceridemia. Acta Med. Scand. 219:435-447[Medline].

  23. Hegele, R. A., Little, J. A., Vezina, C., Maguire, G. F., Tu, L., Wolever, T. S., Jenkins, D. J. A., Connelly, P. W. 1993. Hepatic lipase deficiency. Clinical, biochemical, and molecular genetic characteristics. Arterioscler. Thromb. 13:720-728[Abstract/Free Full Text].

  24. Thuren, T., Wilcox, R. W., Sisson, P., Waite, M. 1991. Hepatic lipase hydrolysis of lipid monolayers. Regulation by apolipoproteins. J. Biol. Chem. 266:4853-4861[Abstract/Free Full Text].

  25. Hime, N., Barter, P., Rye, K . 1998. The influence of apolipoproteins on the hepatic lipase-mediated hydrolysis of high density lipoprotein phospholipid and triacylglycerol. J. Biol. Chem. 273:27191-27198[Abstract/Free Full Text].

  26. Jahn, C. E., Osborne, J. C., Schaffer, E. J., Brewer, H. B. 1983. Activation of the enzymic activity of hepatic lipase by apolipoprotein A-II. Characterization of a major component of high density lipoprotein as the activating plasma component in vitro. Eur. J. Biochem. 131:25-29[Medline].

  27. Shirai, K, Barnhart, R. L., Jackson, R. L. 1981. Hydrolysis of human plasma high density lipoprotein 2- phospholipids and triglycerides by hepatic lipase. Biochem. Biophys. Res. Commun. 100:591-599[Medline].

  28. Mowri, H-O., Patsch, J. R., Gotto, A. M., Jr., Patsch, W. 1996. Apolipoprotein A-II influences the substrate properties of human HDL2 and HDL3 for hepatic lipase. Arterioscler. Thromb. Vasc. Biol. 16:755-762[Abstract/Free Full Text].

  29. Mowri, H-O., Patsch, W., Smith, L. D., Gotto, A. M., Jr., Patsch, J. R. 1992. Different reactivities of high density lipoprotein2 subfractions with hepatic lipase. J. Lipid Res. 33:1269-1279[Abstract].

  30. Tikkanen, M. J., Nikkila, E. A., Kuusi, T., Sipinen, S. 1981. Different effects of two progestins on plasma high density lipoprotein (HDL2) and postheparin plasma hepatic lipase activity. Atherosclerosis. 40:365-369[Medline].

  31. Moorjani, S., Dupont, A., Labrie, F., Lupien, P. J., Gagne, C., Brun, D., Giguere, M., Belanger, A., Cusan, L. 1988. Changes in plasma lipoproteins during various androgen suppression therapies in men with prostatic carcinoma: effects of orchiectomy, estrogen, and combination treatment with luteinizing hormone-releasing hormone agonist and flutamide. J. Clin. Endocrinol. Metab. 66:314-322[Abstract].

  32. Brinton, E. A. 1996. Oral estrogen replacement therapy in postmenopausal women selectively raises levels and production rates of lipoprotein A-I and lowers hepatic lipase activity without lowering the fractional catabolic rate. Arterioscler. Thromb. Vasc. Biol. 16:431-440[Abstract/Free Full Text].

  33. Glad, B. W., Wilson, D. E., Cook, D. B., Working, P. K ., Adler, M. E. 1978. Heparin resistance and decreased hepatic triglyceride hydrolase release during long-term estrogen-progestin treatment. Metabolism. 27:53-60[Medline].

  34. Staels, B., Jansen, H., van Tol, A., Stahnke, G., Will, H., Verhoeven, G., Auwerx, J. 1990. Development, food intake, and ethinylestradiol influence hepatic triglyceride lipase and LDL-receptor mRNA levels in rats. J. Lipid Res. 31:1211-1218[Abstract].

  35. Srivastava, R. A. K, Kitchens, R. T., Schonfeld, G. 1994. Regulation of the apolipoprotein AIV gene expression by estrogen differs in rat and mouse. Eur. J. Biochem. 222:507-514[Medline].


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Lipid Res.Home page
S. Dugue-Pujol, X. Rousset, D. Chateau, D. Pastier, C. Klein, J. Demeurie, C. Cywiner-Golenzer, M. Chabert, P. Verroust, J. Chambaz, et al.
Apolipoprotein A-II is catabolized in the kidney as a function of its plasma concentration
J. Lipid Res., October 1, 2007; 48(10): 2151 - 2161.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. Delgado-Lista, F. Perez-Jimenez, T. Tanaka, P. Perez-Martinez, Y. Jimenez-Gomez, C. Marin, J. Ruano, L. Parnell, J. M. Ordovas, and J. Lopez-Miranda
An Apolipoprotein A-II Polymorphism (-265T/C, rs5082) Regulates Postprandial Response to a Saturated Fat Overload in Healthy Men
J. Nutr., September 1, 2007; 137(9): 2024 - 2028.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. Hsueh, E. D. Abel, J. L. Breslow, N. Maeda, R. C. Davis, E. A. Fisher, H. Dansky, D. A. McClain, R. McIndoe, M. K. Wassef, et al.
Recipes for Creating Animal Models of Diabetic Cardiovascular Disease
Circ. Res., May 25, 2007; 100(10): 1415 - 1427.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Brown, A. Gauthier, R. J. Parks, R. McPherson, D. L. Sparks, J. R. Schultz, and Z. Yao
Severe Hypoalphalipoproteinemia in Mice Expressing Human Hepatic Lipase Deficient in Binding to Heparan Sulfate Proteoglycan
J. Biol. Chem., October 8, 2004; 279(41): 42403 - 42409.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. C. de Beer, L. W. Castellani, L. Cai, A. J. Stromberg, F. C. de Beer, and D. R. van der Westhuyzen
ApoA-II modulates the association of HDL with class B scavenger receptors SR-BI and CD36
J. Lipid Res., April 1, 2004; 45(4): 706 - 715.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. Conde-Knape, A. Bensadoun, J. H. Sobel, J. S. Cohn, and N. S. Shachter
Overexpression of apoC-I in apoE-null mice: severe hypertriglyceridemia due to inhibition of hepatic lipase
J. Lipid Res., December 1, 2002; 43(12): 2136 - 2145.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. Julve, J. C. Escola-Gil, V. Ribas, F. Gonzalez-Sastre, J. Ordonez-Llanos, J. L. Sanchez-Quesada, and F. Blanco-Vaca
Mechanisms of HDL deficiency in mice overexpressing human apoA-II
J. Lipid Res., October 1, 2002; 43(10): 1734 - 1742.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
H. Jansen, A. J. M. Verhoeven, and E. J. G. Sijbrands
Hepatic lipase: a pro- or anti-atherogenic protein?
J. Lipid Res., September 1, 2002; 43(9): 1352 - 1362.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Gautier, D. Masson, M. C. Jong, L. Duverneuil, N. Le Guern, V. Deckert, J.-P. P. de Barros, L. Dumont, A. Bataille, Z. Zak, et al.
Apolipoprotein CI Deficiency Markedly Augments Plasma Lipoprotein Changes Mediated by Human Cholesteryl Ester Transfer Protein (CETP) in CETP Transgenic/ApoCI-knocked Out Mice
J. Biol. Chem., August 23, 2002; 277(35): 31354 - 31363.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
F. Blanco-Vaca, J. C. Escola-Gil, J. M. Martin-Campos, and J. Julve
Role of apoA-II in lipid metabolism and atherosclerosis: advances in the study of an enigmatic protein
J. Lipid Res., November 1, 2001; 42(11): 1727 - 1739.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F. M. van 't Hooft, G. Ruotolo, S. Boquist, U. de Faire, G. Eggertsen, and A. Hamsten
Human Evidence That the Apolipoprotein A-II Gene Is Implicated in Visceral Fat Accumulation and Metabolism of Triglyceride-Rich Lipoproteins
Circulation, September 11, 2001; 104(11): 1223 - 1228.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
C. C. Hedrick, L. W. Castellani, H. Wong, and A. J. Lusis
In vivo interactions of apoA-II, apoA-I, and hepatic lipase contributing to HDL structure and antiatherogenic functions
J. Lipid Res., April 1, 2001; 42(4): 563 - 570.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. von Eckardstein, J.-R. Nofer, and G. Assmann
High Density Lipoproteins and Arteriosclerosis : Role of Cholesterol Efflux and Reverse Cholesterol Transport
Arterioscler. Thromb. Vasc. Biol., January 1, 2001; 21(1): 13 - 27.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weng, W.
Right arrow Articles by Breslow, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weng, W.
Right arrow Articles by Breslow, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Molecular and Cellular Proteomics   ASBMB Today