|
 |
|
|||||||
|
|||||||||
Correspondence to:
Donald B. Jump
The glycolytic enzyme, L-pyruvate kinase (L-PK), plays an important role in hepatic glucose metabolism. Insulin and glucose induce L-PK gene expression, while glucagon and polyunsaturated fatty acids (PUFA) inhibit L-PK gene expression. We have been interested in defining the PUFA regulation of L-PK. The cis-regulatory target for PUFA action includes an imperfect direct repeat (DR1) that binds HNF-4. HNF4 plays an ancillary role in the insulin/glucose-mediated transactivation of the L-PK gene. Because the fatty acid-activated nuclear receptor, peroxisome proliferator-activated receptor (PPAR
These studies suggest that other intermediary factors are involved in both the PUFA and PPAR
Supplementary key words:
Hepatic nuclear factor-4 (HNF4), peroxisome proliferators, cytochrome P450 4A, glycolysis, lipogenesis
Liver-type pyruvate kinase (L-PK) plays a central role in glycolysis by regulating the flux through the phosphoenolpyruvate/pyruvate cycle. Acute control of L-PK involves phosphorylation and allosteric factors. Chronic control involves changes in gene expression mediated by both hormones and nutrients (1). Although insulin and glucose augment L-PK gene expression, the role of insulin in this process is to increase glucokinase levels and stimulate glucose metabolism (2) (3). Enhanced glucose metabolism, possibly through the pentose phosphate pathway, may also be important for induction of hepatic L-PK gene expression (2) (3).
Studies in primary hepatocytes have identified a cis-regulatory region within the L-PK promoter required for glucose-mediated transactivation. This region is located between -183 and -96 bp upstream from the L-PK transcription start site and is termed glucose (or carbohydrate) response region [GlRR/CHORR] (4) (5) (6) (7). The GlRR contains binding sites for 3 classes of transcription factors. Two E-boxes (CANNTG) separated by 5 nucleotides bind USF-related transcription factors. Mutational analyses have shown that the E-boxes are critical for glucose induction of L-PK gene transcription. However, studies using USF1 or USF2-null mice and dominant negative versions of USF1 and USF2 in primary hepatocytes have not clarified the role these transcription factors play in the glucose control of this gene (8) (9). The identity of the glucose-regulated transcription factor controlling L-PK gene transcription is unknown.
Mutational analyses have identified a second region that plays a key ancillary role in glucose-mediated transactivation of L-PK (5) (6) (7). This region, located between -145 and -120 bp, contains an imperfect direct repeat of TGAACT separated by one nucleotide and is termed a DR1. This region binds HNF4 and NF1 (4) (9) (10). HNF4 has a stimulatory role, while NF1 may be inhibitory to L-PK gene expression (10). NF1 also binds at -115/-97 bp .
L-PK gene expression is suppressed by diabetes, glucagon, and polyunsaturated fatty acids [PUFA] (1) (2) (3) (4) (11) (12). Highly unsaturated fatty acids like eicosapentaenoic acid (20:5, n;–3) are particularly strong suppressors of L-PK gene expression (11) (12). PUFA-regulated factors interfere with the glucose-mediated transactivation of L-PK by targeting the 3' region of the GlRR. This PUFA-response region (PUFA-RR) is located between -145 and -120 bp and contains the DR1 binding site for HNF4 (12).
We have been interested in defining the molecular basis of PUFA control of L-PK gene expression. A likely candidate for this control is the peroxisome proliferator-activated receptor (PPAR)
Based on this evidence and the fact that PUFA regulation of L-PK targets a region containing a DR1 (12) there is the possibility that PPAR
Animals and diets
Northern and nuclear run-on analysis
Rat liver nuclei were extracted and used for nuclear transcriptional run-on analysis as previously described (11). cDNAs used in this analysis included L-pyruvate kinase [L-PK] (11) (12), fatty acid synthase [FAS] (11), acyl CoA oxidase [AOX] (16), cytochrome P450 4A [CYP4A2] (16), and ß-actin (11). Hybridization signals were quantified using a Molecular Dynamics Phosphorimager.
Preparation and transfection of hepatocytes
Cells were transfected using Lipofectin (Life Technologies, Inc., Grand Island, NY) at a ratio of 6.6 µg of Lipofectin to 1 µg of reporter plasmid DNA. Two micrograms of reporter construct were added per 60-mm plate. After overnight transfection, cells were treated for 48 h with serum-free Williams E containing 50 µM albumin (ALB) and 10 mM lactate or 25 mM glucose. Cells were also treated with either oleic acid (18:1, n;–9) or arachidonic acid (20:4, n;–6) at 300 µM in 25 mM glucose media (11) (12). Alternatively, the cells were treated with either DMSO as vehicle or 100 µM WY14,463 or 100 µM gemfibrozil in 25 mM glucose media. CAT activity and protein concentration was measured (16) (23) and results are expressed as CAT activity in units [1 unit of CAT activity = 1 CPM [14C]acetylated chloramphenicol/h/100 µg protein].
Electrophoretic mobility shift assays (EMSA)
5' to 3' CCGAACGTGACCTTTGTCCT [AOX-PPRE] (24);
5' to 3' AGCTTGCAGGTGACCTTTGCCCAGCGCCA [ApoCIII-DR1] (22);
5' to 3' CTCCCGTGGTTCCTGGACTCTGGCCCCCAGTG TACAA [L-PK-LFA1] (12);
5' to 3' GATCCTCAGGTCAAAGGTCAGAG [DR-1] (26).
Statistical analysis
Effects of dietary fat and WY14,643 on liver L-PK and CYP4A2 mRNA abundance
To determine whether the effects of fish oil and WY14,643 on L-PK mRNA were due to changes in gene transcription, transcriptional run-on analysis of nuclei isolated from livers of the animals described in Fig 1a was performed. Run-on results for FAS, CYP4A, and ß-actin are presented for controls for the specificity of response. Fig 1b is a representative autoradiogram illustrating the run-on data for L-PK, FAS, ß-actin, CYP4A, and AOX. L-PK, CYP2A, and ß-actin run-on activity in rat liver is low relative to FAS. L-PK run-on activity was suppressed 73% and 84% by fish oil and WY14,643 treatment, respectively. FAS run-on activity was suppressed 85% after fish oil feeding, but was not significantly affected by WY14,643 feeding. CYP4A run-on activity was marginally (20%) induced by fish oil and induced 2-fold after WY14,643 feeding. ß-Actin run-on activity was not significantly affected by fish oil or WY14,643.
Comparing the effect of both fish oil and WY14,643 on the suppression of mRNALPK (Fig 1a) and run-on activity (Fig 1c) indicates that the principal mechanism for WY14,643 and fish oil control of L-PK gene expression is at the transcriptional level. While FAS transcription was suppressed by fish oil ingestion, feeding WY14,643 did not significantly affect FAS gene transcription or mRNAFAS. The pronounced effect of both fish oil and WY14,643 on mRNACYP4A, with marginal effects on run-on activity, may indicate that these treatments may affect mRNACYP4A stability, as well as CYP4A gene transcription.
WY14,643 and clofibrate, but not PUFA, require the PPAR
A similar analysis was performed with two hypolipidemic drugs, i.e., clofibrate and WY14,643. Mice were fed diets supplemented with clofibrate (0.5%, w/w) or WY14,643 (0.1%, w/w) for 2 weeks (Fig 2b) (14). As before (Fig 2a), L-PK mRNA was increased 50% in the PPAR
Localization of the cis-regulatory target for the PPAR
Our next objective was to establish that WY14,643 could activate the endogenous PPAR
LPK-CAT reporter plasmids were transfected into primary hepatocytes to assess their responsiveness to WY14,643. Our initial test used a deletion analysis to localize the cis-regulatory region for WY14,643 control. Because L-PK gene expression and LPK-CAT activity is induced by insulin/glucose (5) (6) (7) (8) (9), cells were treated with lactate (10 mM), glucose (25 mM), or glucose (25 mM) plus WY14,643 (100 µM). LPK-CAT reporter genes with 5' end points at -2800, -197, and -96 bp upstream from the L-PK transcription start site were used. Glucose induced LPK2800 and LPK197 4.8- and 6.5-fold, respectively. However, glucose did not significantly induce LPK96 or TK223. The lack of a glucose effect on TK223 indicates the specificity of the glucose effect. The lack of a glucose effect on LPK96 is consistent with the deletion of the glucose response region (GlRR) located between -197 and -96 bp in the LP-K promoter (7).
When compared to the glucose-treated cells, the glucose-WY14,643 treatment suppressed LPK-CAT2800 and LPK197 CAT activity by 40 and 50%, respectively. A similar analysis of cells receiving only lactate showed that WY14,643 had no effect on LPK-CAT activity (not shown). This indicates that WY14,643 interfered with the glucose/insulin-mediated transactivation of L-PK. This notion is reinforced by the absence of a significant WY14,643 effect on LPK-96, a reporter plasmid containing no GlRR. Based on this deletion analysis, the cis-regulatory target for WY14,643 action is between -197 and -96 bp, the putative GlRR.
The GlRR contains two functional regions (Fig 4b), a USF region binding E-box-related proteins like USF1 and USF2 and a direct repeat (DR1) element binding HNF4 (2) (3) (4) (5) (6) (7) (8). Previous studies had established that the cis-regulatory target for PUFA control of L-PK gene transcription was the 3'-half of the GlRR, i.e., between -145 and -120 bp, a region binding HNF4 (12). Here we asked whether WY14,643 targeted the same regulatory elements as PUFA. The LPK-CAT reporter plasmids containing linker scanning mutations, LPK-LS4 (at -142 to -135 bp) and LS5 (at -130 to -123 bp), span the HNF4 binding site (-144 to -126 bp). CAT activity in cells transfected with LPK-CAT-LS4 did not respond to glucose or WY14,643. CAT activity in cells transfected with LPK-CAT-LS5 was marginally (68%) induced by glucose, but was not affected by WY14,643 treatment. This loss of response cannot be explained by low CAT activity because CAT activity in cells transfected with either LPK-LS4 and LPK-LS5 was higher than LPK197 (Fig 4 legend). Other linker scanning mutations both upstream and downstream of the LS4 and LS5 mutations did not affect WY14,643-regulated CAT activity (not shown). These studies indicate that activated endogenous PPAR
The PPAR
PPAR
To verify that PPAR
L-pyruvate kinase (L-PK) is a glycolytic enzyme that plays an important role in glucose metabolism (1) (2) (3) (4). In addition to acute regulation by phosphorylation and allosteric factors, L-PK gene expression is regulated by hormones (insulin, glucagon) and nutrients (glucose, alanine, and PUFA). The cis-regulatory targets for insulin, glucose, and PUFA regulation have been localized to the GlRR between -183 and -125 bp upstream from the transcription start site (Fig 4b). Insulin-stimulated glucose metabolism regulates the activity of transcription factors, possibly USF-related factors, that bind E-boxes within the GlRR. HNF4 plays an important ancillary role in this regulatory process.
Our studies show that the PPAR
In addition to the L-PK LFA1 element, HNF4 also bound the AOX and apoC-III DR1-like elements (Fig 5). While the effect of HNF4 on AOX has not been established, Hertz et al. (21) (22) reported that PPAR
The fact that PPAR
Interestingly, peroxisome proliferators have been reported to augment rodent hepatic
An alternative explanation for the WY14,643 effect on L-PK may rest in the growth-promoting effects of this compound on the liver (14). WY14,643 along with other peroxisome proliferators induce two mitogen-activated protein kinases (MAPK), e.g., ERK1 and ERK2, in immortalized mouse liver cells (36). Inhibition of MAPK signaling pathways increase HNF4 abundance and possibly its activity in HepG2 cells (37). Whether WY14,643 regulation of L-PK involves the suppression of HNF4 abundance/activity will require additional study.
Finally, as an important glycolytic enzyme, suppression of L-PK gene expression by PUFA and hypolipidemic drugs might be expected to affect hepatic glucose metabolism. Indeed, pyruvate kinase activity as well as the ATP:ADP ratio are lower in clofibrate-treated rats (38). However, clinical studies have indicated that glucose tolerance or insulin resistance is unaffected in hypertriglyceridemic patients treated with the hypolipidemic drug, gemfibrozil (39). It is noteworthy that the PPAR
DAP is a Lilly Fellow of the Life Sciences Research Foundation. This research was supported by USDA (98-352006064) and NIH (DK-43220) grants to DBJ.
Manuscript received October 1, 1999; and in revised form January 25, 2000
Abbreviations:
L-PK, liver type pyruvate kinase; GlRR, glucose response region; CHORR, carbohydrate response region; PUFA, polyunsaturated fatty acids; MLTF, major late transcription factor; HNF4, hepatocyte nuclear factor 4; LF-A1, liver factor activator 1; NF1, nuclear factor 1; PPAR, peroxisome proliferator-activated receptor; RXR, retinoid X receptor; CYP4A2, cytochrome P450 A2; CAT, chloramphenicol acetyltransferase; AOX, acyl CoA oxidase; AOX-PPRE, acyl-CoA oxidase peroxisome proliferator response element; IVTT, in vitro transcription translation; EMSA, electrophoretic mobility shift assays; DR1, direct-repeat-1
Copyright © 2000 by Lipid Research, Inc.
Original Article
Evidence against the peroxisome proliferator-activated receptor
David A. Pana,
Michelle K. Matera,
Annette P. Thelena,
Jeffrey M. Petersb,
Frank J. Gonzalezb, and
Donald B. Jumpa
(PPAR) as the mediator for polyunsaturated fatty acid suppression of hepatic L-pyruvate kinase gene transcription
a Departments of Physiology, Biochemistry, Botany, and Plant Pathology, Michigan State University, East Lansing, MI 48824
b Laboratory of Metabolism, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
), binds DR1-like elements and has been reported to interfere with HNF4 action, we examined the role PPAR plays in the regulation of L-PK gene transcription. Feeding rats either fish oil or the potent PPAR activator, WY14,643, suppressed rat hepatic L-PK mRNA and gene transcription. The PPAR-null mouse was used to evaluate the role of the PPAR in hepatic transcriptional control of L-PK. While WY14,643 control of L-PK gene expression required the PPAR, PUFA regulation of L-PK gene expression was independent of the PPAR. Transfection studies in cultured primary hepatocytes localized the cis-regulatory target for WY14,643/PPAR action to the L-PK HNF4 binding site. However, PPAR/RXR heterodimers did not bind this region. Although both WY14,643 and PUFA suppress L-PK gene transcription through the same element, PUFA regulation of L-PK does not require the PPAR and PPAR/RXR does not bind the L-PK promoter. regulation of L-PK gene transcription.—Pan, D. A., M. K. Mater, A. P. Thelen, J. M. Peters, F. J. Gonzalez, and D. B. Jump. Evidence against the peroxisome proliferator-activated receptor (PPAR) as the mediator for polyunsaturated fatty acid suppression of hepatic L-pyruvate kinase gene transcription. J. Lipid Res. 2000. 41: 742;–751.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
. This view is based on the following evidence. First, the PPAR is the principal PPAR subtype expressed in liver and its activity is controlled by structurally diverse hydrophobic molecules, including fatty acids (13) (14) (15). Previous studies in our lab have shown that the PPAR is required for PUFA-mediated induction of the peroxisomal enzyme acyl CoA oxidase and the microsomal enzyme CYP4A2 (16). Second, the PPAR forms heterodimers with RXR that bind DR1-type elements in promoters of regulated genes (13) (16) (17). The PPAR/RXR heterodimer can induce the expression of multiple hepatic genes involved in fatty acid transport, binding, and oxidation (13) (18) (19) (20). Finally, Hertz et al. (21) (22) have reported that the PPAR competes with HNF4 for binding a DR1 element within the apoC-III and transferrin promoters. Their studies showed that while HNF4 binding supports apoC-III promoter activity, the PPAR suppresses promoter activity. /RXR may compete with HNF4 binding the DR1 to suppress L-PK gene transcription. We have tested this hypothesis by evaluating the effect of PPAR activators, i.e., WY14,643, gemfibrozil, clofibrate, on L-PK gene transcription and mRNA levels in rat and mouse liver and rat primary hepatocytes. These studies will show that while PPAR activators affect L-PK gene expression in vivo and in primary hepatocytes, this effect does not involve direct interaction of PPAR with the L-PK promoter.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Male Sprague-Dawley rats (125;–150 g) were obtained from the Charles River Breeding Laboratories (Kalamazoo, MI). Hepatic RNA samples from male C57BL/6N X Sv/129 mice (25;–35 g), F6 homozygote wild-type (+/+) or PPAR-null (-/-) mice were obtained from two previous feeding studies (14) (16). Rats were housed in the Michigan State University Animal facility, and all experimental protocols were approved by the All University Animal Use Committee at Michigan State University. With the exception of mice fed clofibrate or WY14,643, the animals were trained to a meal-feeding regimen of a high carbohydrate diet (16) (23). Test diets for rats consisted of a high carbohydrate (58% glucose) diet (ICN, Cleveland, OH) supplemented with either 10% (w/w) of complex fats (triolein, olive oil, fish (menhaden) oil), 0.1% WY-14,643 (ChemSyn Laboratories, Lenexa, KS) or 0.2% gemfibrozil (Sigma, St. Louis, MO) for 5 days. Diets were supplemented with 0.1% butylated hydroxytoluene as an antioxidant. Mice were fed clofibrate or WY14,643 at 0.5% or 0.1% (w/w) in a chow control diet for a 2-week period.
Total RNA from rat and mouse livers and from cultured rat hepatocytes was isolated and used for Northern analysis (12) (23). Hybridization was quantified using a Molecular Dynamics phosphorimager (Sunnyvale, CA). The cDNA probes used for L-PK, microsomal cytochrome P450 4A2 (CYP4A2), fatty acid synthase, and ß-actin were described previously (12) (23). PO (Genbank accession #
Z29530) encodes a highly conserved rodent ribosomal phosphoprotein. The human version of this sequence is 3B64. A PO cDNA was prepared by RT-PCR of rat liver RNA using the following sense and antisense primers: [sense: ATATATGAATTCC GTGATG CCCAGGGAAGACAGGCGA; antisense:ATATATGGA TCCTCATCGG ATTCCTCCGACTC]. PO was used in place of ß-actin in some studies to monitor the specificity of drug effects on hepatic gene expression.
Primary rat hepatocytes were isolated by a modified collagenase perfusion method as described by Mater, Thelen, and Jump (23). For RNA studies, primary hepatocytes were plated onto 100-mm Primaria plates at 107 cells/plate in Williams E medium containing 10 mM lactate, 10% fetal bovine serum, 200 nM insulin, 10 nM dexamethasone, 100 U penicillin/ml, and 100 µg streptomycin/ml. For transfection studies, hepatocytes were plated on 60-mm Primaria plates at 3 x 106 cells/plate in the same medium. After an attachment period of approximately 6 h, the cells were washed with phosphate-buffered saline (PBS), switched to serum-free Williams E media containing 10 mM lactate, and transfected with cesium chloride-purified reporter plasmids. The construction of the chloramphenicol acetyltransferase (CAT) reporter plasmids used in this report were described previously (12) (16). LPK-CAT-2800 contains the L-PK promoter extending from -2800 to +12 bp; PKCAT-197 contains the L-PK promoter extending from -197 to +12 bp; LPK-CAT-96 contains the L-PK promoter extending from -96 to +12 bp; LPKCAT-LS4 and LPK-CAT-LS5 contain linker scanning mutations within the -197/+12 region at -143/-135 and -130/-123 bp. The TK223 construct contains the rat AOX-peroxisome proliferator response region fused upstream from the thymidine kinase promoter [TK] (16).
The PPAR and the RXR were synthesized in vitro using TNT® T7 coupled reticulocyte lysate (IVTT) system (Promega, Milwaukee WI). HNF4 was synthesized in vitro using a T3 coupled IVTT and the plasmid BL-rHNF4 [obtained from F. M. Sladek] (24). These expression plasmids produce a single protein using [35S]methionine labeling. EMSA was carried out as described (25) using 32P-labeled DNAs (~20,000 cpm) and in vitro synthesized PPAR, RXR, or HNF4 (2 µl each) in 25 mM Tris-Cl, pH 7.5, 40 mM KCl, 0.1% Nonidet P-40, 1 µg of poly(dI:dC), 10% glycerol. After incubation at room temperature, samples were electrophoretically separated in 10% acrylamide:bisacrylamide (BioRad) with 90 mM Tris borate, pH 8.3, 2.5 mM EDTA as buffer (150 V for 1 h). In binding competition studies, 1 fmol to 1 pmol (in 10-fold increments) of competitor DNA (non-radioactive) was preincubated with IVTT nuclear receptors for 20 min at room temperature prior to the addition of 32P-labeled DNA. After electrophoretic separation, the gels were dried and exposed to X-ray films. The sense oligonucleotides used in the competition studies were:
All data are presented as either mean ± SD or mean ± SE. Statistical comparisons were made by a single-factor factorial analysis of variance (ANOVA; = 0.05) using Microsoft Excel version 7.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
The PPAR is activated in vivo by both WY14,643 and fish oil feeding (14) (16). The effects of these compounds on rat liver mRNAs encoding L-PK, FAS, CYP4A2, and ß-actin were compared ( Fig 1). CYP4A2 was used as a positive control for PPAR activation (16) while ß-actin was used to assess the specificity of the treatment effect. Animals were meal-fed high carbohydrate diets supplemented with triolein or fish oil at 10% (w/w) or WY14,643 at 0.1% (w/w) for 5 days. When compared to triolein-fed animals, fish oil and WY14,643 suppressed L-PK by 81 and 83%, respectively. FAS mRNA was suppressed 70% by fish oil, but was not significantly affected by WY14,643. While mRNACYP4A was induced 3.7- and 6.7-fold, respectively, ß-actin was not significantly affected by these treatments.
View larger version (71K):
[in a new window]
Figure 1.
Effect of dietary fat and WY14,643 on rat hepatic L-PK, FAS, CYP4A, and ß-actin gene expression. Rats were meal fed a high carbohydrate (HiCHO) (58% glucose) diet supplemented with either triolein [10%, w/w] (open bars), fish oil [10%, w/w](black), or WY14,643 [0.1% w/w] (gray bars) for 5 days. A: Effect of dietary fat and WY14,643 on L-PK gene expression. Total hepatic RNA was prepared and analyzed by Northern analyses for the effect of feeding on L-PK, FAS, CYP4A, and ß-actin mRNA abundance. Hybridization was quantified by phosphorimager analysis and normalized against the level of expression of each mRNA in liver of triolein-fed rats. Results are presented as mean ± SE with 4 animals/group (n = 4). The results of this analysis are representative of 3 separate studies. (*) designates a statistical difference (P 
0.05) between the triolein and fish oil-fed animals or the triolein and the WY14,643-fed animals. The mean ± SE phosphorimager units from the Northern analysis for the L-PK, FAS, CYP4A, and ß-actin in triolein-fed rats are: 36569 ± 8009; 36723 ± 8190; 542311 ± 68589; 36806 ± 5923, respectively. B and C: Transcriptional run-on analysis. Run-on analysis was preformed on nuclei derived from the same animals as described in Fig 1a (11). Fig 1b is a representative hybridization dot blot illustrating the level of hybridization for L-PK, FAS, CYP4A2, AOX, and ß-actin. Fig 1c represents the quantified data for L-PK, FAS, CYP4A, and ß-actin. AOX is not illustrated because it displays the same control as CYP4A. The level of hybridization was quantified by phosphorimager analysis and normalized against the level of run on activity in the triolein meal-fed rats. The mean ± SD phosphorimager units from the run-on analysis for the L-PK, FAS, CYP4A, and ß-actin in triolein-fed rats are: 5042 ± 561; 39705 ± 7153; 2549 ± 956; 5262 ± 411, respectively. Results are presented as mean ± SD with 4 animals/group. (*) designates statistically significant difference (P 0.05) between the triolein and fish oil-fed animals or the triolein and the WY14,643-fed animals. to suppress L-PK gene expression
Finding that both fish oil and WY14,643 regulate L-PK gene transcription is consistent with a role for PPAR as a regulator of L-PK gene expression (Fig 1). To determine whether PPAR is required for the transcriptional effects of fish oil and WY14,643 on L-PK, we took advantage of the PPAR-null mouse (14). In the first study, wild-type (+/+) and PPAR-null (-/-) mice were fed a high carbohydrate diet supplemented with either olive or fish oil at 10% w/w for 5 days ( Fig 2a). Interestingly, mRNALPK levels in livers of olive oil-fed animals were increased 2-fold in the PPAR-null mice when compared to the wild-type animals. When compared to olive oil-fed animals, hepatic mRNALPK was suppressed 50% in the wild-type animals and 70% in the PPAR-null mice with fish oil feeding. By comparison, fish oil induced mRNACYP4A2 6.2-fold in the wild-type, but had no significant effect on CYP4A expression in the PPAR-null mice. ß-Actin remained unaffected by these treatments. These results indicate that while the PPAR is required for PUFA induction of mRNACYP4A2, it was not required for the PUFA-mediated suppression of mRNALPK.
View larger version (43K):
[in a new window]
Figure 2.
Effect of dietary fat and hypolipidemic drugs on L-PK and CYP4A2 gene expression in wild-type (+/+) and PPAR null (-/-) mice. A: Effect of fish oil on L-PK and CYP4A expression in wild type and PPAR null mice. Mice from each genotype were meal-fed high carbohydrate (HiCHO) diets supplemented with 10% (w/w) olive or fish oil for 5 days. At the conclusion of the dietary treatment, liver RNA was extracted and assayed for the expression of L-PK and CYP4A2 as described in Fig 1. The effects of this feeding protocol on mRNAs encoding ß-actin, AOX, CYP4A, S14, and FAS from wild-type and PPAR-null mice was reported previously (16). ß-Actin expression was not significantly affected by olive or fish oil feeding (16). The CYP4A data is shown here for comparison. The level of expression is normalized against the level of expression in livers of olive oil-fed wild-type mice. The phosphorimager units for L-PK, CYP4A, and ß-actin in the olive oil-fed wild-type mice are: 907514 ± 170647, 1025984 ± 112813, and 20407 ± 6854, respectively. Results are expressed as mean ± SE with 4 animals/group. The statistical comparisons (ANOVA) were: (*) olive oil wild-type versus fish oil-fed wild-type mice (P 0.1); olive oil wild-type vs. olive oil PPAR-null type (P 0.1); (**) olive oil-PPAR null type vs. fish oil-PPAR null type (P 0.05). No other comparisons were significant. B: Effect of clofibrate and WY14,643 on L-PK, CYP4A2, and PO gene expression in wild-type (+/+) and the PPAR-null (-/-) mice. PO (a ribosomal phosphoprotein) is used here instead of ß-actin, to assess the specificity of the treatment as well as to assess RNA loading of the agarose gels. Mice of each genotype were fed a chow diet [Bioserve, NJ] supplemented with 0.5% (w/w) clofibrate or 0.1% (w/w) WY14,643 for 2 weeks, ad libitum (14). Total liver RNA was prepared and examined by Northern blot analysis for L-PK, CYP4A2, and PO mRNA levels. The effects of this feeding protocol on mRNAs encoding ß-actin, AOX, and CYP4A from wild-type and PPAR-null mice was reported previously (14). ß-Actin expression was not significantly affected by clofibrate or WY14,643 (14). The results were quantified and normalized against the level of hepatic mRNA expressed in control-fed rats. The phosphorimager units for L-PK, CYP4A, and PO in the control-fed wild type mice are: 7278 ± 621, 90270 ± 42745, and 10925 ± 627, respectively. These results are represented as mean ± SD with 3 animals/group. The statistical comparisons (ANOVA) were: (*) +/+ control versus +/+ clofibrate or +/+ WY14,643-fed mice (P 0.1). No other comparisons were significant.-null mice when compared to wild-type mice. In wild-type mice, both clofibrate and WY14,643 suppressed mRNALPK by 
80%. Drug treatment of the PPAR-null mice had no significant effect on hepatic mRNALPK levels. mRNACYP4A was induced 28- and 81-fold by clofibrate and WY14,643, respectively, in wild-type mice but was not significantly affected by either compound in livers of the PPAR-null mice. mRNAPO, (encodes a ribosomal phosphoprotein) was not significantly affected by these treatments. These results indicate that PPAR is required for the clofibrate and WY14,643 regulation of both L-PK and CYP4A gene transcription. action on the L-PK promoter
As WY14,643 suppression of L-PK gene transcription requires PPAR (Fig 1 and Fig 2), the next step was to localize the cis-regulatory target for this control. Primary hepatocytes have been used previously to assess the role of PUFA on L-PK gene expression (12). To assess PPAR activator control of L-PK gene expression in primary hepatocytes, cells were treated with gemfibrozil or WY14,643 at 100 µM for 48 h. These treatments suppressed mRNALPK levels by 45 and 80%, respectively ( Fig 3). mRNACYP4A2 was induced 8.4- and 33-fold by these same treatments, while ß-actin was unaffected. Clearly, these PPAR activators act directly on primary rat hepatocytes to promote a robust gene-specific response, a response that parallels the one seen in vivo (Fig 1).
View larger version (19K):
[in a new window]
Figure 3.
Effect of gemfibrozil and WY14,643 on L-PK, CYP4A, and ß-actin mRNAs in primary rat hepatocytes. Primary rat hepatocyte cultures were fed Williams E media containing 25 mM glucose, 200 nM insulin, 10 nM dexamethasone. Control cultures received DMSO (0.1%), the vehicle for gemfibrozil and WY14,643. Treated cultures received gemfibrozil or WY14,643 at 100 µM for 48 h. All cultures received one media change. At the end of the treatment period, total RNA was isolated and analyzed by Northern blots for L-PK, CYP4A2, and ß-actin mRNA. The results were quantified and normalized against the level of expression of each mRNA in vehicle (DMSO) treated cells. The phosphorimager units for L-PK, CYP4A, and ß-actin of vehicle-treated cells are: 22808 ± 2671, 12957 ± 745, and 316050 ± 14187, respectively. Results are presented as the mean ± SD, with 3 plates of cells/group. Results are representative of 2 separate experiments. The statistical comparisons (ANOVA) were: (*) vehicle vs. gemfibrozil or WY14,643 (P 0.02). and control the expression of a transfected reporter gene in primary hepatocytes. Accordingly, primary hepatocytes were transfected with TK223, a reporter plasmid containing the AOX-PPRE linked to the thymidine kinase (TK) promoter ( Fig 4). CAT activity in cells transfected with TK223 was induced >3.2-fold by WY14,643. More robust transactivation of TK223 was achieved by co-transfecting a PPAR expression vector (25).
View larger version (54K):
[in a new window]
Figure 4.
Localization of the cis-regulatory target for WY14,643 regulation of L-PK gene transcription. A: Localization of the WY14,643 cis-regulatory region within the L-PK promoter. A schematic illustrates the reporter plasmids. TK223 contains the acyl CoA oxidase PPRE fused upstream of the thymidine kinase (TK) promoter (25). LPK-2800, LPK-197, and LPK-96 are LPK-CAT reporter plasmids with 5' end points at -2800, -197, and -96 bp. Each has a common 3' end point at +12 bp. The construction of these plasmids was described previously (7) (12). Cultured primary hepatocytes are treated with medium containing 10 mM lactate, 25 mM glucose, or 25 mM glucose plus 100 µM WY14,643. All cultures received insulin at 200 nM. After 48 h in culture with one media change; cells were harvested for measurement of protein and CAT activity. CAT activity for each plasmid is normalized to the level of expression in the lactate-treated cells. CAT activity (Units, see Materials and Methods) in the lactate-treated hepatocytes transfected with TK223, LPK2800, LPK197, and LPK96 was: 96 ± 20, 49 ± 5, 92 ± 20, 212 ± 26 units, respectively. Results are presented as Relative CAT Activity-% of Control [mean ± SE]. The control is the lactate-treated group. The number of plates of cells/treatment were: 12, 6, 24, 6 for TK223, LPK-2800, LPK-197, and LPK-96, respectively. The data presented is pooled data from 2 or more different studies with 3 plates of cells/group within each study. The statistical comparisons (ANOVA) were: (+; P < 0.01) lactate vs. glucose; (*; P < 0.05) glucose vs. glucose plus WY14,643. B: Linker scanning analysis of the L-PK promoter. Schematic of the L-PK promoter illustrating the location of the TATA box (at -28/-23 bp) and binding sites for HNF1 (-94/-76), NF1 (-115/-97), HNF4 binding a DR1 at (-145/-120), and USF related factors binding E-boxes (CANNTG). The schematic denotes the location of the glucose response region (GlRR), and the PUFA-response region (PUFA-RR). LPK-LS4 has a linker scanning mutations at -143/-135 bp while LPK-LS5 has a linker scanning mutation at -130/-123 bp (boxed X). The construction of these plasmids was described previously (7) (12). Primary rat hepatocytes were transfected with the various reporter plasmids, fed media, harvested, and assayed for protein and CAT activity as described above. Results are presented as Relative CAT Activity, % of the Control [mean ± SE]. The control is the lactate-treated group. CAT activity (Units, see Materials and Methods) in the lactate-treated hepatocytes transfected with LPK-197, LPK-LS4, and LPK-LS5 was: 92 ± 20, 249 ± 28, 530 + 143 units, respectively. Results are presented as mean ± SE. The number of plates of cells/treatment were: 24, 6, and 6 for LPK-197, LPK-LS4, and LPK-LS5, respectively. The data presented are pooled data from 2 or more different studies with 3 plates of cells/group within each study. The statistical comparisons (ANOVA) were: (+; P < 0.01) lactate vs. glucose; (*; P < 0.05) glucose versus glucose plus WY14,643. targets the same region within the L-PK promoter as PUFA, i.e., the PUFA-regulatory region. does not bind the L-PK promoter
WY14,643, acting through PPAR (Fig 2), targets the 3' end of the L-PK GlRR (Fig 4), a region binding HNF4 (2) (3) (4) (5) (6) (7) (8). The HNF4 binding site is a direct repeat with a single nucleotide spacer, i.e., a DR1. PPAR/RXR heterodimers bind DR1-like elements in the AOX, apoC-III, and transferrin promoters (21) (22) (25). PPAR/RXR heterodimers compete with HNF4 for the DR1 site in the apoC-III and transferrin promoters (21) (22). To determine whether WY14,643 regulation of L-PK gene transcription was analogous to that reported for apoC-III, electrophoretic mobility shift analysis was used. , RXR, and HNF4 were prepared by in vitro transcription/translations (see Materials and Methods). SG5 was used as a control for an unprogrammed transcription/translation. Direct binding of these receptors to the 3' end of the L-PK GlRR, i.e., (LFA1), the AOX-peroxisome proliferator response element (AOX), the apoC-III HNF4 binding site (apoC-III) and an artificial direct repeat (DR1) was tested ( Fig 5A). HNF4 bound the LFA1, AOX, apoC-III, and the DR1 elements. RXR alone bound only the artificial DR1 element, while PPAR alone did not bind any element. The combination of PPAR/RXR bound both the AOX and apoC-III element. However, PPAR/RXR did not bind the LPK-LFA1 element. The binding activity in the PPAR/RXR for DR1 probably represents the RXR homodimer.
View larger version (27K):
[in a new window]
Figure 5.
Electrophoretic mobility shift analysis of PPAR binding to DNA. A: Direct electrophoretic mobility shift assays. Direct binding of in vitro synthesized HNF4, PPAR, RXR, or PPAR/RXR heterodimer was assessed using 32P-DNAs: the LPK-LFA1 [LFA1], the AOX-PPRE [AOX], the ApoCIII-DR1 [ApoCIII] or an artificial DR-1, as described in Materials and Methods. SG5 was used to program the in vitro transcription/translation reaction and provides a control for background binding from the reticulolysate. Labeled DNAs were incubated in a 20 µl reaction for 20 min with 2 µl of lysate programmed with SG5, RXR, PPAR, the PPAR/RXR heterodimer, or HNF4. The arrow at the right indicates the location of the nuclear receptor-DNA complex. Free probe is not shown in the figure. Faint bands detected in the SG5 lane that correspond to bands seen in other lanes are considered to be derived from the unprogrammed reticulolysate. The results are representative of 4 separate studies. B: Competitive electrophoretic mobility shift assays. Competitive EMSA was performed using a 32P-labeled acyl-CoA oxidase;–peroxisomal proliferator response element (AOX-PPRE) oligonucleotide and in vitro transcribed/translated PPAR and RXR. Competition assays were performed in the presence of 0 to 100-fold molar excess (0;–1 pmol) of unlabeled AOX-PPRE, apolipoprotein C-III (ApoCIII), and LPK LF-A1. The LF-A1 element spans nucleotides -156 to -120 bp and contains the PUFA-RR. The sequence of oligonucleotides used in this analysis is shown in Materials and Methods. The results are representative of 3 separate studies./RXR did not bind the L-PK LFA1, competition gel shift analysis was used (Fig 5B). In the left panel, PPAR/RXR heterodimer binding to the 32P-AOX-PPRE was tested with increasing concentration of non-radioactive AOX-PPRE. Quantitation of the inhibition of PPAR/RXR binding yielded a Kd = ~4 nM. A similar result was obtained with the apoC-III element as competitor. However, the L-PK LFA1 element failed to compete for PPAR/RXR binding to the AOX element, even at a 1000-fold molar excess. HNF4 bound the LFA1 with a Kd of ~5 nM (not shown). If these binding relationships prevail in vivo, then it is highly unlikely that PPAR/RXR binds the L-PK DR1. This finding indicates that WY14,643 suppression of L-PK gene transcription, a PPAR-dependent event, does not involve direct interaction with the L-PK promoter. Thus, WY14,643/PPAR regulation of L-PK gene transcription involves some intermediary factor(s).
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
activators, WY14,643, gemfibrozil, and clofibrate, induce hepatic mRNACYP4A2 and suppress mRNALPK through a transcriptional regulatory mechanism both in vivo and in cultured primary hepatocytes (Fig 1 Fig 2 Fig 3 Fig 4). While PPAR is required for the WY14,643 suppression of L-PK, PPAR is not required for the PUFA suppression of L-PK gene transcription (Fig 2). Thus, PPAR is not a mediator of PUFA regulation of L-PK gene transcription despite the fact that both WY14,643 and PUFA target the same cis-regulatory element within the L-PK promoter (Fig 4). This cis-regulatory target is the 3' end of the GlRR, a region containing an imperfect direct repeat (-143TGGACTCTGGCCC-131) that binds HNF4. Similar DR-like elements are recognized by a number of orphan nuclear receptors including PPAR, RXR, CoupTFI, and CoupTFII (27). Neither PPAR, RXR or the PPAR/RXR heterodimers bound the L-PK LFA1 (Fig 5). In studies not reported here, CoupTF1 or CoupTFII (apoA-I) failed to bind the L-PK LFA1 site. /RXR heterodimers competed with HNF4 for binding the apoC-III DR1. HNF4 binding stimulated apoC-III promoter activity, while PPAR/RXR binding inhibited apoC-III promoter activity. Clearly, WY14,643/PPAR regulation of L-PK through an HNF4 binding site does not parallel the mechanism described for apoC-III. /RXR heterodimers do not directly interact with the L-PK promoter suggests that WY14,643 regulation of L-PK gene transcription through PPAR involves some intermediary mechanism ( Fig 6). Studies will need to establish whether HNF4 binding the L-PK LFA1 is affected after fish oil or WY14,643 feeding of animals. Interestingly, NF-1-related factors also bind the 3' end of the L-PK GlRR (10). Several NF1 subtypes have been described including NF-1L and NF1/Red1. Yamada et al. (10) have suggested that NF1 binding the L-PK promoter inhibits L-PK activity. Thus, one attractive scenario would involve PUFA and WY14,643 control of hepatic HNF4 abundance, its DNA binding activity or its capacity to transactivate. A decline in HNF4 activity or abundance might increase binding of other factors, like NF1, to the L-PK LFA1 and inhibit L-PK gene transcription. In this regard, Hertz et al. (28) have reported that fatty acyl CoA thioesters affect HNF4 binding and transactivation on the apoC-III promoter. We have been unable to extend this observation to the L-PK promoter.
View larger version (18K):
[in a new window]
Figure 6.
PUFA and PPAR regulate L-PK gene transcription through separate mechanisms. A schematic of the L-PK promoter is shown illustrating the targets for USF-related proteins and HNF4 within the GlRR. Both PPAR and PUFA-regulated factors act on the L-PK DR1. Fibrates are strong activators of the PPAR, while n;–3 PUFA are weak activators (25). N;–6 PUFA do not activate PPAR under the experimental conditions used in this study. PPAR does not bind the L-PK DR1 suggesting an intermediary component is involved in the PPAR regulation of L-PK through the PUFA-RR. The intermediary component remains to be identified.
6-desaturase activity (29). 6-Desaturase is required to convert 18:2, n;–6 to 20:4, n;–6 and 22:5, n;–6. 20:4, n;–6 is a potent suppressor of L-PK gene transcription. There are, however, two lines of evidence that argue against this mechanism to explain WY14,643 control of L-PK gene transcription. First, highly unsaturated fatty acids suppress nuclear levels of sterol response element binding protein, SREBP1c (30) (31) (32). SREBP1c is involved in the coordinate control of multiple hepatic lipogenic genes (33). While SREBP1c binds E-boxes and SREs in specific promoters of PUFA-regulated genes, such as ACC, FAS, and S14 (32) (34), it does not bind the L-PK promoter at either the E-boxes or the LFA1 region (32). Second, fatty acid synthase expression, a sensitive index for hepatic PUFA suppression through SREBP1c, was not significantly affected by WY14,643 feeding (Fig 1). Moreover, peroxisome proliferators have no effect on SREBP1 mRNA or its nuclear content (32) (35) -null mice exhibit a phenotype with altered metabolic characteristics. L-PK mRNA is elevated in null mice compared to wild-type mice (Fig 2). This represents a critical partitioning between gluconeogenesis and fatty acid oxidation and the relationship between fuel oxidation and storage. In contrast to saturated fats, PUFA are readily oxidized (40). Nevertheless, PUFA also constitute structural membrane lipid components whereby increased amounts of PUFA are associated with reduced insulin resistance (41). When the PPAR is eliminated from the system, as is the case in the PPAR-null animals, a major lipid handling system is negated and glycolysis is switched on, a compensatory process in keeping with the Randle cycle (42). Isolating the mechanistic details of dietary fat handling, be it as fuels in oxidation, as structural components, or as regulators of gene expression, is an area that requires elucidation not only for basic understanding but also in the amelioration of numerous metabolic diseases including obesity and Type II diabetes mellitus.
ACKNOWLEDGMENTS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
(PPAR). J. Biol. Chem. 273:5678-5684. Nature. 392:512-516[Medline].
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Wang, M. Torres-Gonzalez, S. Tripathy, D. Botolin, B. Christian, and D. B. Jump Elevated hepatic fatty acid elongase-5 activity affects multiple pathways controlling hepatic lipid and carbohydrate composition J. Lipid Res., July 1, 2008; 49(7): 1538 - 1552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. I Martinelli, N. O Mocchiutti, and C. A Bernal Dietary di(2-ethylhexyl)phthalate-impaired glucose metabolism in experimental animals Human and Experimental Toxicology, September 1, 2006; 25(9): 531 - 538. [Abstract] [PDF]
|
|
|
|
|
|
Y. Wang, D. Botolin, J. Xu, B. Christian, E. Mitchell, B. Jayaprakasam, M. Nair, J. M. Peters, J. Busik, L. K. Olson, et al. Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity J. Lipid Res., September 1, 2006; 47(9): 2028 - 2041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Xu, B. Christian, and D. B. Jump Regulation of Rat Hepatic L-Pyruvate Kinase Promoter Composition and Activity by Glucose, n-3 Polyunsaturated Fatty Acids, and Peroxisome Proliferator-activated Receptor-{alpha} Agonist J. Biol. Chem., July 7, 2006; 281(27): 18351 - 18362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Botolin, Y. Wang, B. Christian, and D. B. Jump Docosahexaneoic acid (22:6,n-3) regulates rat hepatocyte SREBP-1 nuclear abundance by Erk- and 26S proteasome-dependent pathways J. Lipid Res., January 1, 2006; 47(1): 181 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. B. Jump, D. Botolin, Y. Wang, J. Xu, B. Christian, and O. Demeure Fatty Acid Regulation of Hepatic Gene Transcription J. Nutr., November 1, 2005; 135(11): 2503 - 2506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Le May, M. Cauzac, C. Diradourian, D. Perdereau, J. Girard, A.-F. Burnol, and J.-P. Pegorier Fatty Acids Induce L-CPT I Gene Expression through a PPAR{alpha}-Independent Mechanism in Rat Hepatoma Cells J. Nutr., October 1, 2005; 135(10): 2313 - 2319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang, D. Botolin, B. Christian, J. Busik, J. Xu, and D. B. Jump Tissue-specific, nutritional, and developmental regulation of rat fatty acid elongases J. Lipid Res., April 1, 2005; 46(4): 706 - 715. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-P. Pegorier, C. L. May, and J. Girard Control of Gene Expression by Fatty Acids J. Nutr., September 1, 2004; 134(9): 2444S - 2449S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. J. Jiang, B. Lu, F. Y. Xu, J. Gartshore, W. A. Taylor, A. J. Halayko, F. J. Gonzalez, J. Takasaki, P. C. Choy, and G. M. Hatch Stimulation of cardiac cardiolipin biosynthesis by PPAR{alpha} activation J. Lipid Res., February 1, 2004; 45(2): 244 - 252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pawar, D. Botolin, D. J. Mangelsdorf, and D. B. Jump The Role of Liver X Receptor-{alpha} in the Fatty Acid Regulation of Hepatic Gene Expression J. Biol. Chem., October 17, 2003; 278(42): 40736 - 40743. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pawar and D. B. Jump Unsaturated Fatty Acid Regulation of Peroxisome Proliferator-activated Receptor {alpha} Activity in Rat Primary Hepatoctes J. Biol. Chem., September 19, 2003; 278(38): 35931 - 35939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Botolin and D. B. Jump Selective Proteolytic Processing of Rat Hepatic Sterol Regulatory Element Binding Protein-1 (SREBP-1) and SREBP-2 During Postnatal Development J. Biol. Chem., February 21, 2003; 278(9): 6959 - 6962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pawar, J. Xu, E. Jerks, D. J. Mangelsdorf, and D. B. Jump Fatty Acid Regulation of Liver X Receptors (LXR) and Peroxisome Proliferator-activated Receptor alpha (PPARalpha ) in HEK293 Cells J. Biol. Chem., October 11, 2002; 277(42): 39243 - 39250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. J. Waterman and V. A. Zammit Differential Effects of Fenofibrate or Simvastatin Treatment of Rats on Hepatic Microsomal Overt and Latent Diacylglycerol Acyltransferase Activities Diabetes, June 1, 2002; 51(6): 1708 - 1713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. Jump The Biochemistry of n-3 Polyunsaturated Fatty Acids J. Biol. Chem., March 8, 2002; 277(11): 8755 - 8758. [Full Text] [PDF]
|
|
|
|
 |
|
 S. KERSTEN, S. MANDARD, P. ESCHER, F. J. GONZALEZ, S. TAFURI, B. DESVERGNE, and W. WAHLI The peroxisome proliferator-activated receptor {alpha} regulates amino acid metabolism FASEB J, September 1, 2001; 15(11): 1971 - 1978. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Duplus, M. Glorian, and C. Forest Fatty Acid Regulation of Gene Transcription J. Biol. Chem., September 29, 2000; 275(40): 30749 - 30752. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Journal of Biological Chemistry |
| Molecular and Cellular Proteomics | ASBMB Today |