|
|
||||||||
Correspondence to:
M. Bard, To whom correspondence should be addressed., mbard{at}iupui.edu (E-mail)
The ERG28 gene was originally identified by microarray expression profiling as possibly involved in the Saccharomyces cerevisiae sterol pathway. Microarray analyses suggested that the transcription pattern of ERG28 closely followed that of genes involved in sterol synthesis. ERG28 was also found in Schizosaccharomyces pombe and Arabidopsis as well as humans, and in the latter was shown to be highly expressed in adult testis tissue. All four proteins contain potential transmembrane domain(s). Gas chromatography-mass spectrometry analysis of an ERG28-deleted S. cerevisiae strain (which is slow growing but not auxotrophic for ergosterol) indicates a lesion in sterol C-4 demethylation. Sterol profiles indicate accumulation of 3-keto and carboxylic acid sterol intermediates, which are involved in removing the two C-4 methyl groups from the sterol A ring. Similar intermediates have previously been demonstrated to accumulate in erg26 (sterol dehydrogenase/decarboxylase) and erg27 (3-ketoreductase) mutants in yeast.
We speculate that the role of the Erg28 protein (Erg28p) may be either to tether Erg26p and Erg27p to the endoplasmic reticulum or to facilitate interaction between these proteins.Gachotte, D., J. Eckstein, R. Barbuch, T. Hughes, C. Roberts, and M. Bard. A novel gene conserved from yeast to humans is involved in sterol biosynthesis. J. Lipid Res. 2001. 42: 150;154.
Supplementary key words:
ergosterol, C-4 demethylation, Saccharomyces cerevisiae
All genes encoding known enzymes in the Saccharomyces cerevisiae ergosterol (ERG) biosynthetic pathway have now been cloned. Beginning with ERG10, which encodes acetoacetyl-CoA thiolase, and ending with ERG4, which encodes the sterol C-24 reductase, there are 22 genes responsible for interconversions leading to ERG (1). DNA transcriptional microarray analyses, however, showed that an uncharacterized S. cerevisiae open reading frame (ORF), YER044c, responded similarly to ERG biosynthetic genes when ERG biosynthesis was inhibited by mutation of ERG pathway genes or the addition of azoles (2). Deletion of the YER044c gene, now designated ERG28, resulted in induction of other genes in the ERG pathway consistent with a sterol defect. While ERG28 is not essential for viability, it is required for a normal growth rate (3).
In yeast, plants, and animals, conversion of lanosterol to zymosterol requires demethylation of the C-14 carbon, and two rounds of demethylation at C-4 (4). The first step in removal of a single C-4 methyl group requires a C-4 sterol methyl oxidase, which converts each methyl group by a series of three oxidations to a carboxylic acid. A dehydrogenation at the C-3 hydroxy leads to the spontaneous loss of the C-4 carboxyl group as CO2 catalyzed by the C-3 sterol dehydrogenase/C-4 decarboxylase. This decarboxylation results in a C-3 ketone that is converted back to the alcohol by the 3-ketoreductase. The genes encoding these enzymes have been cloned in our laboratory and are designated ERG25, ERG26, and ERG27, respectively (5) (6) (7). All three are essential because deletions in any one leads to sterol auxotrophy. In the present study, we demonstrate by gas chromatography-mass spectrometry (GC-MS) that the ERG28 gene product is necessary for efficient C-4 demethylation of sterols. While significant amounts of ERG and ERG precursors accumulate in a deleted erg28 strain, a number of novel intermediates occur which, using GC-MS, we identify as 3-keto and carboxylic acid sterol (CAS) intermediates, some of which have been observed in strains containing lesions in ERG26 and ERG27, respectively. We suggest that the ERG28 gene product may anchor the C-3 sterol dehydrogenase/C-4 decarboxylase and 3-ketoreductase enzymes to the endoplasmic reticulum (ER), because unlike most ERG biosynthetic enzymes these lack an obvious transmembrane domain.
Construction of erg28 deletion strains
PCR amplification of the WT yeast Saccharomyces ERG28 and human ERG28 genes
Plasmid pDW394 containing the YEplac 195 vector backbone (11) into which the HOR7 promoter and the PGKt terminator region were inserted was obtained from Acacia Biosciences (Richmond, CA). A 71-bp oligomer primer containing 50 bases of HOR7 promoter and 21 bases of human ERG28 (hERG28) leader sequence just upstream of the ATG (TATCAAATCATACAGATA TTGTCAAAAAAAAAAAAGACTAATAATAAAAACACGTTTGAG GGGAGTCATGA) and a 79-bp oligomer containing 56 bases of the PGKt terminator region and 20 bases of the reverse complement of the hERG28 ORF termination region (TAAAGGATG GGGAAAGAGAAAAGAAAAAAATTGATCTATCGATTTCAATTT TAAAATTAAAGAGGAGAGACGACGAAGG) were used to PCR amplify human testis cDNA (InVitrogen, Carlsbad, CA) using a Taq/Pfu mixture. A yeast erg28 null mutant was then cotransformed with the 570-bp PCR product and the pDW394 plasmid was gapped by HindIII and SphI. Selection for URA3 transformants results in the generation of circular recombinant plasmid after homologous recombination (12) (13). The resulting plasmid pDW394::hERG28 was sequenced with the HOR7 (GCTCAC TATGTGACAGTTC) and PGKt primers (GGCATTAAAAGAGGA GCGAA) to confirm the hERG28 sequence. Inserts were confirmed by sequencing, using the ABI 377 automated DNA sequencer.
Strains, media, and transformations
Sterol extraction and analyses
DNA and amino acid sequence of the conserved ERG28 gene
The sERG28 DNA sequence encodes a 148-amino acid sequence, and homologs to this gene have been observed in Schizosaccharomyces pombe, Arabidopsis, and in humans. In humans, it is found to be highly expressed in adult testis and in several cancer lines (17). Fig 1 demonstrates the homology between these conserved sequences from Saccharomyces, Sch. pombe, humans, and Arabidopsis thaliana. Between Sch. pombe and S. cerevisiae there is 40% sequence identity and 81% sequence similarity, between S. cerevisiae and humans there is 29% identity and 64% sequence similarity, and between S. cerevisiae and A. thaliana there is 25% identity and 61% sequence similarity. The two yeast proteins contain at least one transmembrane domain, Arabidopsis contains at least two, and the human protein contains at least three based on the Kyte-Doolittle (18) algorithm of 19 amino acids and a threshold of 1.6. Interestingly, only the human protein contains a KKXX Golgi-to-ER retrieval signal at the carboxyl-terminal end (19). This amino acid sequence appears in the Saccharomyces and human C-4 sterol methyl oxidase proteins.
GC-MS analysis of erg28
Table 2 illustrates the breakdown of free and esterified sterols in the WT and erg28 mutant. In the WT only 3-hydroxysterols accumulate, with 79% of the sterols free and 21% esterified. Free ERG comprises 59.5% of total ERG. Whereas ERG comprises 66.5% of the total sterol in WT, it accounts for only 27.4% of the total sterol in erg28. This may account for the observation that this strain is slow growing but not auxotrophic. Only a small percentage of the total sterol in erg28 is esterified, which is consistent with the observation that esterification occurs when free sterol is in excess with regard to the cell's requirement for membrane sterol (20). However, a small percentage of the total CAS is also esterified. Last, erg28 accumulates small amounts of two 3-hydroxysterols that could not be identified.
Complementation of the Saccharomyces erg28 strain with sERG28 and hERG28 genes
Because the enzymes required for sterol biosynthesis (beginning with squalene synthase) are localized to the ER, it is not surprising that many have transmembrane-spanning (TM) domains. Among the five enzymes that do not contain such domains, Erg26p, Erg27p, Erg1p, Erg6p, and Erg7p, the latter three are found both in the ER and in cytoplasmic lipid particles (23). However, Erg26p and Erg27p, also lacking TM domains, are found exclusively in the ER and it is likely that the role of Erg28p (which contains a TM domain) may be to facilitate protein-protein interactions between the Erg26 dehydrogenase and the Erg27 3-keto reductase and/or to tether these enzymes to the ER. The advantage of having a protein that facilitates the complete demethylation of C-4 sterols would be to prevent accumulation of oxygenated C-4 intermediates (carboxylic acid and keto sterols), which may be toxic to the cell. Further, 3-keto intermediates are not esterifiable and CAS, while esterifiable, may be poor substrates for the esterification enzymes (Table 2). Whatever the exact role of Erg28p may be, as an anchor or even as a regulatory protein, it appears that this protein is conserved in sterol biosynthetic pathways from yeast to humans.
rapid communication
This work was supported in part by National Institutes of Health Grants R01 AI38598 and R01 GM62104 to M.B. We thank Ms. Janica Mullen and Mr. Chris Rush for technical assistance.
Manuscript received August 8, 2000; and in revised form September 11, 2000
Abbreviations:
CAS, carboxylic acid sterols; ER, endoplasmic reticulum; ERG, ergosterol; GC-MS, gas chromatography-mass spectrometry; hERG28, human ERG28 gene; sERG28, Saccharomyces ERG28 gene; TM, transmembrane; WT, wild type
Copyright © 2001 by Lipid Research, Inc.
Rapid Communication
A novel gene conserved from yeast to humans is involved in sterol biosynthesis
D. Gachottea,
J. Ecksteinb,
R. Barbuchb,
T. Hughesc,
C. Robertsc, and
M. Barda
a Department of Biology, Indiana University-Purdue University Indianapolis, Indianapolis, IN 46202
b Department of Drug Disposition, Eli Lilly and Co., Lilly Corporate Center, Indianapolis, IN 46285
c Rosetta Inpharmatics, Inc., Kirkland, WA 98034
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Wild-type (WT) strains BY4741 and BY4742 have been previously described and are the parental strains used by the yeast deletion consortium to assess the essentiality of each yeast gene (8). R711 and R712 were isolated as erg28 G418-resistant segregants of BY4743 heterozygous for ERG28 (Mata/
erg28::kanMX4/ERG28 his3
1his3
1 leu2
0/leu2
0 met15
0/MET15 lys2
0/LYS2 ura3
0/ura3
0). Deletions were made according to the deletion module polymerase chain reaction (PCR) strategy (9), in which ERG28-specific primers 5' and 3' to the ORF, respectively, GATGTCCACGAGGTCTCTACATGAGGAGCAGTTTGCATCGTA CGCTGCAGGTCGAC and CGGTGTCGGTCTCGTAGAATCCAG TCGGAATCATGGCATCGATGAATTCGAGCTCG, were used to amplify a kanMX4 cassette such that the entire ERG28 ORF was deleted and replaced by the kanamycin resistance (KanR) cassette. Verification of the deletion involved 5' and 3' flanking primers A (GCTACTATTTTTGACGTAAACGCAT) and D (TTA AATAATGTACGGAAGGTTTGGA) and the two primers common to the kanMX4 module, kanB (CTGGACCGAGGAGCC GTAAT) and kanC (TGATTTTGATGACGAGCGTAAT). Two other primers internal to the ERG28 gene, primers B (TTCAAG TACATAGCCCCATAGAATC) and C (CATGTCTTATATGGTTGC CCTATTC), failed to generate PCR product in conjunction with the A and D primers, respectively, in the disrupted strain.
A 1.3-kb EcoRI-BamHI fragment containing the entire Saccharomyces ERG28 (sERG28) ORF, 440 base pairs (bp) of promoter, and 319 bp of downstream DNA sequence was amplified by PCR and inserted into vector pRS306 (10) to give pIU1600. PCR was performed on a Perkin-Elmer (Norwalk, CT) 2400 thermocycler using Pfu DNA polymerase and the sERG28 gene was sequenced by the Biochemistry Biotechnology Facility at the Indiana University School of Medicine (Indianapolis, IN), using a Perkin-Elmer Biosystems (Foster City, CA) model ABI 373 automated DNA sequencer.
Yeast strains were grown at 30°C in YPAD medium [1% yeast extract, 2% Bacto-peptone, 2% glucose, and adenine (20 mg/l)] and grown for approximately 18;20 h to an OD600 of 4;6. Transformants of erg28 were grown on complete synthetic medium-uracil medium containing 0.67% yeast nitrogen base, 2% glucose, and amino acids and nitrogen base supplements at 0.8% (Bio 101, La Jolla, CA). Yeast strains were transformed by standard methods (14). The Escherichia coli strain DH5
(F-
80dlacZ
M15
(lacZYA-argF )U169 deoR recA1 endA1 phoA hsdR17(rk-, mk+) supE44
- thi-1 gyrA96 relA1) was transformed as previously described (14) and grown in Luria-Bertani medium with ampicillin (50 µg/ml) at 37°C.
Total lipids were extracted from cells grown overnight in the presence of acid-washed glass beads according to the method of Bligh and Dyer (15). Phospholipids were precipitated at -20°C in the presence of acetone;chloroform 10:1 (v/v) followed by centrifugation at 12,300 g as described previously (6). CAS present in the sterol extract were methylated with diazomethane generated from N-methyl-nitrosourea in a 40% KOH solution and extracted with ethyl ether. Free sterols, 3-keto sterols, CAS, and sterol esters were resolved on 60 TLC F254-precoated silica gel plates (E. Merck, Darmstadt, Germany) with methylene chloride as the solvent system. Organic compounds were detected after spraying with a 0.1% berberin sulfate ethanolic solution after exposure to short wavelength ultraviolet light irradiation. Hydroxysterols, 3-keto sterols, and CAS fractions were eluted from silica plates using methylene chloride. Alternatively, for complementation analyses sterols were extracted by saponification of whole cells as described by Molzahn and Woods (16). This protocol was used to detect free and 3-keto sterols. GC-MS analyses of sterols were done with a Varian (Palo Alto, CA) 3400 gas chromatograph interfaced to a Finnigan MAT TSQ 700 mass spectrometer. The GC separations were done on a fused silica column (DB-5, 15 m x 0.32 mm x 0.25 µm film thickness; J&W Scientific, Folsom, CA), programmed from 50 to 250°C at 20°C/min after a 1-min hold at 50°C. The oven temperature was held at 250°C for 10 min before programming the temperature to 300°C at 20°C/min. Helium was the carrier gas with a linear velocity of 50 cm/s in the splitless mode. The mass spectrometer was in the electron impact ionization mode at an electron energy of 70 eV, an ion source temperature of 150°C, and scanning from 40 to 650 atomic mass units at 0.5-s intervals.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Hughes et al. (2) demonstrated by microarray analyses that the ERG28 transcript is induced in erg11, erg2, erg3, and WT strains treated with azole antifungals. Furthermore, the overall pattern of transcriptional regulation of the ERG28 transcript relative to the ERG26 and ERG27 transcripts showed correlations in more than 300 experiments of 0.843 and 0.835, respectively. Only ERG5 and ERG9 had slightly higher correlation coefficients (r = 0.853) to ERG28 from among the 6326 yeast genes analyzed.

View larger version (75K):
[in a new window]
Figure 1.
Alignment of the amino acid sequences encoded by the ERG28 gene from S. cerevisiae, Sch. pombe, Homo sapiens, and A. thaliana. Shaded areas indicate regions of sequence identity. The alignment was done with Genetics Computer Group (CGG) Wisconsin package version 9.1. Accession numbers for the Sch. pombe, human, and Arabidopsis versions of ERG28 are T40262, NP 009107, and T00622, respectively.
Nonsaponifiable sterol analyses using GC-MS previously indicated that a number of novel sterols accumulated in the erg28-disrupted strain relative to the WT (2), but none of these sterols were identified. The sterol fraction from the erg28 disruptant, isolated as described in Materials and Methods, was subject to thin-layer chromatography with CH2Cl2 as solvent. A polar fraction representing CAS derivatized with diazomethane had an Rf of ~0.05 followed by several fractions containing free 3-hydroxysterols and 3-keto sterols (Rf = 0.22 to Rf = 0.35). Quantifiable GC analyses of the free sterols, 3-keto sterols, and CAS sterols for the WT and erg28 deletion strains are given in Table 1 along with relative retention times. Total sterols for both the WT and erg28 mutant were similar: 1.823 and 1.596 mg/g dry weight. However, no 3-keto sterols or CAS were found in the WT strain whereas in erg28 only 38.3% of total sterols were 3-hydroxysterols and 36.2% and 25.5% were 3-keto sterols and CAS, respectively (also see Table 2). Table 1 also indicates that in the 3-hydroxysterol fraction, ERG comprised 66% of the total in WT and 71% of the total in erg28. The observation that a yeast sterol strain can simultaneously accumulate 3-hydroxysterols, 3-keto sterols, and CAS in significant quantities and still not be auxotrophic is suggestive of a partial block in the steps involved in C-4 demethylation. We previously demonstrated that erg26 mutants accumulate CAS and erg27 mutants accumulated 3-keto sterols but were unable to demonstrate accumulation of all three types of sterol in any C-4 demethylation mutant.
View this table:
[in a new window]
Table 1.
Distribution of free hydroxy, 3-keto, and carboxylic acid sterols in erg28 mutant and wild-type strains
View this table:
[in a new window]
Table 2.
Influence of the erg28 disruption on the accumulation pattern of free and esterified sterols
pIU1600, an integrating vector containing the sERG28 gene, was transformed into erg28 by integrating the plasmid at the ura3-52 locus. A high copy number plasmid (pDW394) containing the PCR-amplified hERG28 gene was similarly transformed into erg28 and the sterol profiles for both are shown in Fig 2. The sterol profile from the S. cerevisiae complementing strain (Fig 2A) gave a nearly WT sterol profile, in which the largest peak was ERG (peak 2) with significant amounts of zymosterol (peak 1), fecosterol (peak 3), ergosta-5,7-dien-3ß-ol (peak 4), episterol (peak 5), lanosterol (peak 6), and 4,4-dimethyzymosterol (peak 7) accumulating. While no 3-keto sterols were detected, increased levels of WT sterol intermediates relative to ERG were observed. These results are consistent with complementation profiles of other Saccharomyces ERG genes such as erg2 and erg3 (21) (22). The sterol complementation profile using the human gene again gave similar results, but significantly more lanosterol and 4,4-dimethylymosterol accumulated relative to ERG. In addition, a novel sterol, 4-methylfecosterol, which normally does not accumulate in WT Saccharomyces strains, was identified (Fig 2B, peak 8).

View larger version (21K):
[in a new window]
Figure 2.
GC sterol accumulation profile in an erg28 strain complemented with a plasmid containing the sERG28 gene (A) or the hERG28 gene (B). Peak 1, zymosterol; peak 2, ergosterol; peak 3, fecosterol; peak 4, ergosta-5,7-dien-3ß-ol; peak 5, episterol; peak 6, 4-methylfecosterol; peak 7, lanosterol; peak 8, 4,4-dimethyzymosterol.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGMENTS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. R. De Miglio, P. Virdis, D. F. Calvisi, M. Frau, M. R. Muroni, M. M. Simile, L. Daino, G. M. Careddu, E. Sanna-Passino, R. M. Pascale, et al. Mapping a Sex Hormone-Sensitive Gene Determining Female Resistance to Liver Carcinogenesis in a Congenic F344.BN-Hcs4 Rat Cancer Res., November 1, 2006; 66(21): 10384 - 10390. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Valachovic, B. M. Bareither, M. S. A. Bhuiyan, J. Eckstein, R. Barbuch, D. Balderes, L. Wilcox, S. L. Sturley, R. C. Dickson, and M. Bard Cumulative Mutations Affecting Sterol Biosynthesis in the Yeast Saccharomyces cerevisiae Result in Synthetic Lethality That Is Suppressed by Alterations in Sphingolipid Profiles Genetics, August 1, 2006; 173(4): 1893 - 1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Germann, C. Gallo, T. Donahue, R. Shirzadi, J. Stukey, S. Lang, C. Ruckenstuhl, S. Oliaro-Bosso, V. McDonough, F. Turnowsky, et al. Characterizing Sterol Defect Suppressors Uncovers a Novel Transcriptional Signaling Pathway Regulating Zymosterol Biosynthesis J. Biol. Chem., October 28, 2005; 280(43): 35904 - 35913. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mo and M. Bard Erg28p is a key protein in the yeast sterol biosynthetic enzyme complex J. Lipid Res., September 1, 2005; 46(9): 1991 - 1998. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cunningham, D. Swartzlander, S. Liyanarachchi, R. V. Davuluri, and G. E. Herman Changes in gene expression associated with loss of function of the NSDHL sterol dehydrogenase in mouse embryonic fibroblasts J. Lipid Res., June 1, 2005; 46(6): 1150 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Lee, A. K. Hsu, J. Sajdak, J. Qin, and P. Pavlidis Coexpression Analysis of Human Genes Across Many Microarray Data Sets Genome Res., June 1, 2004; 14(6): 1085 - 1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Infante, K. M. Dombek, L. Rebordinos, J. M. Cantoral, and E. T. Young Genome-Wide Amplifications Caused by Chromosomal Rearrangements Play a Major Role in the Adaptive Evolution of Natural Yeast Genetics, December 1, 2003; 165(4): 1745 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Caldas and G. E. Herman NSDHL, an enzyme involved in cholesterol biosynthesis, traffics through the Golgi and accumulates on ER membranes and on the surface of lipid droplets Hum. Mol. Genet., November 15, 2003; 12(22): 2981 - 2991. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Herman Disorders of cholesterol biosynthesis: prototypic metabolic malformation syndromes Hum. Mol. Genet., April 2, 2003; 12(90001): R75 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Hand, N. Jia, M. Bard, and R. J. Craven Saccharomyces cerevisiae Dap1p, a Novel DNA Damage Response Protein Related to the Mammalian Membrane-Associated Progesterone Receptor Eukaryot. Cell, April 1, 2003; 2(2): 306 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Anderson, C. Sirjusingh, A. B. Parsons, C. Boone, C. Wickens, L. E. Cowen, and L. M. Kohn Mode of Selection and Experimental Evolution of Antifungal Drug Resistance in Saccharomyces cerevisiae Genetics, April 1, 2003; 163(4): 1287 - 1298. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mo, M. Valachovic, S. K. Randall, J. T. Nickels, and M. Bard Protein-protein interactions among C-4 demethylation enzymes involved in yeast sterol biosynthesis PNAS, July 23, 2002; 99(15): 9739 - 9744. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Journal of Biological Chemistry |
| Molecular and Cellular Proteomics | ASBMB Today |