J. Lipid Res. Did you know there is a large type edition? Click here.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Winegar, D. A.
Right arrow Articles by Hansen, B. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Winegar, D. A.
Right arrow Articles by Hansen, B. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Journal of Lipid Research, Vol. 42, 1543-1551, October 2001
Copyright © 2001 by Lipid Research, Inc.


Original Article

Effects of fenofibrate on lipid parameters in obese rhesus monkeys

Deborah A. Winegara, Peter J. Browna, William O. Wilkison2,a, Michael C. Lewisa, Ronda J. Otta, W. Q. Tonga, H. Roger Browna, Jurgen M. Lehmann3,a, Steven A. Kliewera, Kelli D. Plunketa, James M. Waya, Noni L. Bodkinb, and Barbara C. Hansenb
a GlaxoSmithKline, Five Moore Drive, Research Triangle Park, NC 27709
b Obesity and Diabetes Research Center, University of Maryland School of Medicine, Baltimore, MD 21201

Correspondence to: Deborah A. Winegar, To whom correspondence should be addressed., daw17189{at}gsk.com (E-mail)


  ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Fenofibrate is a member of the fibrate class of hypolipidemic agents used clinically to treat hypertriglyceridemia and mixed hyperlipidemia. The fibrates were developed primarily on the basis of their cholesterol and triglyceride lowering in rodents. Fibrates have historically been ineffective at lowering triglycerides in experimentally-induced dyslipidemia in nonhuman primate models. The spontaneously obese rhesus monkey is a well-recognized animal model for the study of human obesity and type 2 diabetes, and many of these monkeys exhibit naturally occurring lipid abnormalities, including elevated triglycerides and low HDL cholesterol (HDL-C), similar to patients with type 2 diabetes. To explore whether the obese rhesus model was predictive of the lipid lowering effects of fibrates, we evaluated fenofibrate in six hypertriglyceridemic, hyperinsulinemic, nondiabetic animals in a 20-week, dose-escalating study. The study consisted of a 4-week baseline period, two treatment periods of 10 mg/kg twice daily (b.i.d) for 4 weeks and 30 mg/kg b.i.d. for 8 weeks, and a 4-week washout period. Fenofibrate (30 mg/kg b.i.d) decreased serum triglycerides 55% and LDL-C 27%, whereas HDL-C increased 35%. Apolipoproteins B-100 and C-III levels were also reduced 70% and 29%, respectively. Food intake, body weight, and plasma glucose were not affected throughout the study. Interestingly, plasma insulin levels decreased 40% during the 30 mg/kg treatment period, suggesting improvement in insulin sensitivity.

These results support the use of obese rhesus monkey as an excellent animal model for studying the effects of novel hypolipidemic agents, particularly agents that impact serum triglycerides and HDL-C. — Winegar, D. A., P. J. Brown, W. O. Wilkison, M. C. Lewis, R. J. Ott, W. Q. Tong, H. R. Brown, J. M. Lehmann, S. A. Kliewer, K. D. Plunket, J. M. Way, N. L. Bodkin, and B. C. Hansen. Effects of fenofibrate on lipid parameters in obese rhesus monkeys. J. Lipid Res. 2001. 42: 1543–1551.

Supplementary key words: fibrate, PPAR{alpha}, triglyceride-lowering, HDL-C, apolipoprotein C-III


  INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Fibrates are a class of hypolipidemic drugs used to treat hypertriglyceridemia and mixed hyperlipidemia. Fibrates effectively lower plasma TG and increase HDL cholesterol (HDL-C) levels. These drugs also reduce LDL cholesterol (LDL-C), particularly small dense LDL-C, which is associated with increased risk of atherosclerosis (1) (2). The TG-lowering activity of fibrates has been attributed to both inhibition of hepatic fatty acid synthesis and increased catabolism of TG-rich lipoproteins (3) (4). This increase in VLDL catabolism results from up-regulation of LPL expression (5) and increased LPL activity due to a reduction in serum apolipoprotein C-III (apoC-III) levels (6) (7). The elevation in HDL-C seen with fibrates correlates with increased expression of apoA-I and apoA-II (8) (9).

The fibrates were developed primarily on the basis of their cholesterol- and TG-lowering activity in rodents. In rodents, the fibrates induce a peroxisomal proliferation response in liver characterized by increased peroxisomal fatty acid ß-oxidation and microsomal {omega}-hydroxylation, which lead to hepatomegaly and hepatocarcinogenesis upon prolonged exposure (10) (11). Both the peroxisome proliferation response and the lipid modulating effects of fibrates appear to be mediated through the peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}), a member of the nuclear hormone receptor superfamily known to induce changes in the transcription of genes encoding enzymes involved in lipid and lipoprotein metabolism (reviewed in 12). PPAR{alpha} regulates gene expression in response to naturally occurring fatty acids and other lipophilic ligands by binding as a heterodimer with the retinoid X receptor to peroxisome proliferator response elements lo-cated in the upstream regulatory regions of target genes. PPAR{alpha} expression in rodents is greatest in tissues rich in mitochondrial and peroxisomal ß-oxidation such as liver, kidney, and intestine (13) (14) (15). In contrast, human PPAR{alpha} expression is greatest in skeletal muscle, followed by liver, kidney, and adrenal (15) (16) (17). Several studies have shown that fibrates do not elicit a rodent-type peroxisome proliferation response in primate liver or in primate-derived cultured hepatocytes (18) (19) (20) (21) (22) (23).

We were interested in evaluating fibrate-type activators of PPAR{alpha} in a nonrodent animal model that does not exhibit hepatic peroxisome proliferation in response to fibrates. Nonhuman primates have typically been resistant to the lipid modulating effects of fibrates, except when these drugs are administered at doses well above the clinically effective dose (24) (25) (26). For example, gemfibrozil and clofibrate were required at 3 to 35 times the clinical dose to achieve significant changes in cynomolgus (26) and rhesus monkey serum lipids (24) (25). This may be due to low basal serum lipids among the subjects studied or to species differences in the pharmacokinetic profile of the drugs.

Diet-induced coronary artery atherosclerosis has been studied for many years in nonhuman primates. The progression of the disease in several nonhuman primate species resembles coronary atherosclerosis in humans in many respects (27) (28) (29). Complications associated with coronary atherosclerosis are the leading cause of death in patients with type 2 diabetes (30) (31). Because diabetic individuals frequently exhibit an abnormal serum lipid profile that may be altered by fibrate therapy (32), we searched for a suitable nonhuman primate model of type 2 diabetes to test the effectiveness of a fibrate on modulating serum lipoproteins.

The spontaneously obese rhesus monkey is a well-recognized animal model system for examining the sequence of metabolic changes that are associated with the onset and development of diabetes, including changes in serum lipoproteins (33) (34) (35). These animals frequently exhibit increases in serum triglycerides, VLDL-TG, and VLDL cholesterol (VLDL-C) and decreases in HDL-C, generally consistent with the lipoprotein abnormalities often seen in humans. To explore whether the obese rhesus model was predictive of the lipid-lowering effects of fibrates, we evaluated fenofibrate in six hypertriglyceridemic, hyperinsulinemic, nondiabetic animals in a 20-week dose-escalating study. We show here that fenofibrate produced the same lipid-lowering effects as have been observed in humans: reductions in serum TG, apoC-III, and small dense LDL-C along with increases in HDL-C.


  MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Test material
Fenofibrate was obtained from Sigma Chemical Co. (St. Louis, MO, catalog no. F6020, lot 11H0890) and micronized to a particle size <10 µm.

Cloning of rhesus PPAR{alpha}
Full-length rhesus PPAR{alpha} sequence was identified using overlapping clones generated by PCR from a rhesus liver cDNA library. cDNA encoding the rhesus PPAR{alpha} ligand binding domain was amplified using the following oligonucleotides: forward, CACAAGTGCCTTTCTGTCGGGATG; reverse, TCAGTACATGTC CCTGTAGATCTC. An overlapping fragment encoding the NH2 terminus of rhesus PPAR{alpha} was amplified using the following primer pair: forward, 5' untranslated human PPAR{alpha}-CCAGCAC CATCTGGTCGCGATG; reverse, rhesus PPAR{alpha}-TTCGCAGGTAA GAATTTCTGC). Thirty cycles of PCR amplification were performed using the following cycle conditions: 95°C for 30 s, 56°C for 30 s, and 72°C for 120 s. PCR products were subcloned into pUC18 (Amersham Pharmacia Biotech, Piscataway, NJ.), and 10 independent clones from each PCR reaction were sequenced to confirm the identity of rhesus PPAR{alpha}.

Cotransfection assay
Fibrates were assayed for their ability to activate rhesus and human PPAR-GAL4 chimeric receptors in transiently transfected CV-1 cells, as previously described (36). The rhesus PPAR{alpha}-GAL4 receptor construct was prepared by inserting the ligand binding domain of rhesus PPAR{alpha} (encompassing amino acids 167–468) COOH-terminal to GAL4 in the pSG5 expression vector (Stratagene), as previously described (37). EC50s were calculated as the concentration of compound required to induce 50% of the maximal reporter activity.

Western blotting of rhesus tissues with PPAR{alpha} antibody
Tissue lysates were prepared from young adult and adult normal rhesus monkeys and Western blotted with the PPAR{alpha}-specific monoclonal antibody P{alpha}B11.80A, as previously described (17).

Subjects
Six middle-aged male rhesus monkeys (Macaca mulatta) were studied ( Table 1). All were obese (body fat >30%) and had elevated serum TG (100–325 mg/dl), low HDL-C (26–67 mg/dl), and elevated fasting insulin levels (102–294 µU/ml). LDL-C and fasting plasma glucose levels were normal. The monkeys were maintained in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and protocols were reviewed and approved by the Institutional Animal Care and Use Committee. The monkeys were housed in individual primate cages with a 12-hr light-dark cycle. They were fed Purina Monkey Chow 15 [protein 17.4 ppm, fat 12.6 ppm, carbohydrate 69.9 ppm, cholesterol 119 ppm (communication per Purina Mills)] ad libitum and had unlimited access to fresh water. Food intake was measured daily and recorded as number of biscuits consumed. Body weight was recorded weekly throughout the study.


 
View this table:
[in this window]
[in a new window]
 
Table 1. Baseline characteristics of the study subjects

Study design
The animals were studied during five consecutive 4-week treatment periods as follows: 1) baseline (vehicle); 2) 10 mg/kg b.i.d. fenofibrate; 3) 30 mg/kg b.i.d. fenofibrate (30A); 4) 30 mg/kg b.i.d. fenofibrate (30B); 5) washout (vehicle). Animals were dosed twice daily (~8 AM and 4 PM) with drug incorporated into a vehicle (food snack, banana) or vehicle alone. The doses of fenofibrate were selected based on reported steady state exposure levels in humans receiving a standard dose of 200 mg micronized fenofibrate per day (23 mg/l, ~64 µM) (38), with consideration of historical data showing reduced efficacy of fibrates in nonhuman primates (24) (25) (26). A dose >30 mg/kg was originally planned for this study; however, it was found to require an unacceptably large amount of vehicle for delivery. Thus, it was decided to continue for an additional 4 weeks of dosing at 30 mg/kg b.i.d. Blood samples were collected biweekly under light ketamine sedation 4 h after the morning dose of either vehicle or drug. Before the morning dose on collection days, monkeys were fasted overnight for 16 h. Blood was collected in a vacutainer tube for whole blood and in an EDTA vacutainer tube for preparation of plasma. Serum was prepared by chilling whole blood on ice for up to 30 min followed by centrifugation.

Assays
All parameters were measured biweekly unless otherwise noted. Routine clinical chemistry analyses were performed on frozen serum samples with a Technicon AXON® instrument using standard reagents and protocols. Tests included total cholesterol; total TG; NEFA; liver, renal, muscle, and pancreatic function panels; electrolytes; and serum proteins. Glucose and insulin were measured on fresh plasma using a Beckman Glucose Analyzer II and a double antibody radioimmunoassay using anti-porcine insulin antiserum. Hematology and plasma lipoprotein analyses were performed five times throughout the study: at baseline, at the end of each of the three treatment periods, and at the end of the washout period. A standard hematology panel along with measurement of fibrinogen levels was performed on fresh whole blood by Antech Diagnostic Laboratories (Farmingdale, NY). Plasma lipoprotein analyses were conducted by Medlantic Research Laboratories (Washington, D.C.). Lipoprotein fractions isolated from fresh plasma by isopycnic centrifugation were analyzed for total cholesterol, total TG, HDL-C, LDL-C, VLDL-C, and VLDL-TG content. LDL size was determined by nondenaturing PAGE, and apoB and apoC-III were measured by automated immunoprecipitation analysis.

Serum concentrations of fenofibric acid were measured by a reverse phase HPLC assay. Fenofibric acid is the principal metabolite of fenofibrate and the active form in vivo. Monkey serum (50–500 µl) was extracted with 2 ml acetonitrile by vortexing and centrifugation for 5 min. The supernatant was transferred to a clean tube and evaporated with nitrogen. Samples were then reconstituted with 300 µl of 70% methanol/30% 5 mM ammonium acetate, pH 4.0, and centrifuged before HPLC injection. The HPLC system consisted of an HP1090 autoinjector and pumps, a Symmetry C18 column (3.9 x 150 mm) set at 40°C, and an HP1090 diode array detector set at 300 nm. The mobile phase consisted of 60% methanol/40% 5 mM ammonium acetate, with a flow rate of 1 ml/min and a run time of 15 min. Fenofibric acid eluted at 5.4 min. Calibration standards were prepared in normal rhesus serum. The limits of quantitation for the assay were 70 to 3,486 ng/ml (0.19–9.7 µM). The concentrations of fenofibric acid in the serum samples were calculated from the least-squares linear regression analysis of the logarithmically transformed peak areas and calibration standard concentrations using Microsoft EXCEL.

All data are expressed as mean ± SEM. Differences were evaluated by paired Student's t-test.


  RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cloning and activation of rhesus monkey PPAR{alpha}
Our previous screening of fibrate analogs for activity against PPAR{alpha} revealed distinct species differences in the potency of these compounds between human and murine PPAR{alpha} (36), possibly due to differences in the nucleotide sequences coding for human and murine PPAR{alpha} (94% identity in the ligand binding domain). To determine whether rhesus monkeys are an appropriate model in which to study fibrate-type activators of PPAR{alpha}, we identified clones encoding the entire open reading frame of rhesus monkey PPAR{alpha}. and compared the sequence with human PPAR{alpha}. ( Fig 1a and Fig 1b). Rhesus PPAR{alpha} shares 97% and 99% identity with human PPAR{alpha} cDNA and putative protein sequence, respectively.

A transient cotransfection assay was used to screen fibrate analogs for their activity against rhesus and human PPAR{alpha}. Fenofibrate fully activated rhesus PPAR{alpha} with a potency similar to human PPAR{alpha}, confirming the functionality of the rhesus receptor (EC50s = 42.5 µM for rhesus, 30 µM for human) ( Fig 2). Similar, though less potent, activation of rhesus and human PPAR{alpha} was obtained with bezafibrate and gemfibrozil (Fig 2).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. A: Nucleotide sequence of the rhesus peroxisome proliferator-activated response-{alpha} (PPAR{alpha}) clone and its alignment with the human PPAR{alpha} sequence. B: Predicted protein sequence of rhesus PPAR{alpha} and its alignment with the sequence of human PPAR{alpha} protein. Differences in the nucleotide and amino acid residues between rhesus and human PPAR{alpha} are boxed.

Figure 2. Activity of fibrates on rhesus PPAR{alpha}. Fenofibrate (solid circle), bezafibrate (solid triangle), and gemfibrozil (solid square) were assayed for their ability to activate rhesus PPAR{alpha}-GAL4 chimeric receptors in transiently transfected CV-1 cells, as previously described (29). Data are expressed as a percentage of the maximal effect of a standard control. Each data point represents the mean ± SEM of assays performed in triplicate. EC50 values for fibrates on rhesus PPAR{alpha}: fenofibrate = 42.5 µM; bezafibrate = 220 µM; gemfibrozil = 184 µM.

Tissue distribution of rhesus PPAR{alpha}
In rodents and humans, PPAR{alpha} is highly expressed in tissues that catabolize fatty acids such as liver, heart, kidney, and intestine (13) (14) (15). The relative expression of PPAR{alpha} in human skeletal muscle, however, is much higher than in rodent skeletal muscle (15) (16) (17). We explored the tissue distribution of PPAR{alpha} in normal rhesus monkeys by Western blotting using a PPAR{alpha}-specific monoclonal antibody raised to an NH2-terminal fragment of human PPAR{alpha}. A representative Western blot in Fig 3 shows that rhesus PPAR{alpha} protein expression is similar to humans in that expression in rhesus is highest in skeletal muscle, followed by liver, heart, and brown adipose tissue. Very little PPAR{alpha} was expressed in white adipose tissue.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. Tissue distribution of PPAR{alpha} in normal rhesus monkey. Tissue lysates obtained from a representative normal rhesus monkey (100 µg/lane) were electrophoresed, transferred to PVDF membranes, and immunoblotted with the PPAR{alpha}-specific antisera P{alpha}b11.80A (0.5 µg/ml).

Effects of fenofibrate on lipid parameters in obese rhesus monkeys
The baseline serum TG levels of the six hypertriglyceridemic monkeys studied ranged from 101 to 325 mg/dl, with a mean of 190 mg/dl (Table 1). Treatment for 4 weeks with 10 mg/kg b.i.d. fenofibrate reduced serum TG ~32% ( Fig 4a). Increasing the dose to 30 mg/kg b.i.d. further reduced TG to ~50% of baseline levels. These effects were observed within the first 2 weeks of dosing at 30 mg/kg and were maintained through 8 weeks of dosing. After a 4-week washout period with vehicle, TG levels returned to baseline (Fig 4a). In general, animals with the highest baseline TG levels showed the greatest reponse to fenofibrate.





View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Effects of fenofibrate on serum lipid parameters. Data are presented as mean ± SEM for n = 6. +P < 0.05, * P < 0.01, ** P < 0.005, compared to baseline levels. A: Triglycerides. B: LDL-C. C: HDL-C.

There was a trend toward lower serum apoC-III concentrations upon fenofibrate treatment ( Table 2). Serum apoC-III levels decreased 19% and 29% at the 10 and 30 mg/kg doses of fenofibrate, respectively; however, only at the higher dose was the effect significant (P < 0.01).


 
View this table:
[in this window]
[in a new window]
 
Table 2. Effects of fenofibrate on serum apolipoprotein concentrations

Fenofibrate had no significant effect on total serum cholesterol throughout the study (data not shown); however, the drug decreased LDL-C and increased HDL-C levels. LDL-C fell 22% during the first 10 mg/kg treatment period with fenofibrate and held steady through the subsequent two 30 mg/kg treatment periods (Fig 3B). Changes in the composition of the LDL particles were apparent as serum apoB concentrations decreased and LDL particle size increased (Table 2). ApoB levels were reduced 47% at the 10 mg/kg dose and 70% at the 30 mg/kg dose, whereas LDL particle size increased 8% at the 30 mg/kg dose.

As seen in hypertriglyceridemic, insulin-resistant humans, baseline HDL-C levels of the monkeys studied were low relative to normal adult rhesus, ranging from 26 to 67 mg/dl [HDL-C nonobese rhesus ~90 mg/dl (33) (39)] (Table 1). Treatment with fenofibrate increased HDL-C by 18% at the 10 mg/kg dose and 35% at the 30 mg/kg dose (Fig 4b). HDL-C levels returned to baseline during the washout period. An increase was seen in all animals, regardless of the starting baseline HDL-C level. Unexpectedly, fenofibrate treatment did not increase serum apoA-I levels in parallel with the rise in HDL-C levels (data not shown).

In addition to their effects on serum lipids, fibrates are reported to affect other metabolic parameters including insulin and body weight (40) (41) (42) (43) (44) (45). Fasting plasma insulin levels of the monkeys studied averaged 162 µU/ml at baseline (range 102–294 µU/ml) (Table 1). These levels are ~3-fold higher than normal rhesus (33). Fenofibrate reduced insulin by 12% within the first 10 mg/kg treatment period and up to 40% during the subsequent two 30 mg/kg treatment periods ( Fig 5a). Plasma glucose levels were within the normal range at the start of the study and remained unchanged with fenofibrate treatment (Fig 5b). Similarly, body weight and food consumption were not affected by fenofibrate (data not shown). To assess potential liver toxicity, we monitored serum markers of aspartate aminotransferase, alanine aminotransferase, and alkaline phosphatase. All enzyme levels remained in the normal range throughout the study (data not shown).




View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. Effects of fenofibrate on serum insulin (A) and glucose (B) levels. Data are presented as mean ± SEM for n = 6. * P < 0.01 compared with baseline levels.

In support of the efficacy parameters measured, serum levels of fenofibric acid, the principal metabolite of fenofibrate and the active form in vivo, were determined. ( Table 3). Because fenofibric acid serum levels peak between 4 and 6 h after dosing in man, serum samples were taken 4 h after dosing. Fenofibric acid levels averaged 1.95 ± 0.43 µM after the first 10 mg/kg dose. After 2 weeks of 10 mg/kg dosing b.i.d., fenofibric acid levels increased to 8.66 ± 2.31 µM. This 4-fold increase in fenofibric acid serum levels is suggestive of drug accumulation upon multiple dosing.


 
View this table:
[in this window]
[in a new window]
 
Table 3. Serum concentrations of fenofibric acid

Fenofibric acid serum levels did not increase when the dose of fenofibrate was raised to 30 mg/kg (8.07 ± 1.13 µM). In addition, no significant increases were seen upon sustained dosing for a total of 8 weeks at 30 mg/kg b.i.d. This may have been due to differences in the dissolution rate of the compound in the gastrointestinal tract at the higher dose and/or to changes in the Tmax during oral absorption. These drug levels are lower than the EC50 for activation of rhesus PPAR{alpha} (42.5 µM) (Fig 2); however, because only a 4-h serum sample was taken, the drug level at this time point may not accurately reflect expected increases in maximal serum concentrations.


  DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

It is now widely accepted that high plasma TG and low plasma HDL-C levels are associated with increased risk of developing coronary heart disease (46) (47) (48). Fibrates have been used effectively to treat hypertriglyceridemia for many years. Fibrates primarily lower plasma TG, although they also decrease LDL-C and increase HDL-C in some patients (1) (2) (3) (4). Several primary and secondary prevention studies have proven the efficacy of certain fibrates in the prevention of coronary heart disease in dyslipidemic patients (1) (2) (32).

The principal molecular target of fibrates has been identified as the nuclear hormone receptor PPAR{alpha}. An extensive body of data generated primarily in rodents suggests that fibrate activation of PPAR{alpha} regulates the expression of genes involved in lipid and lipoprotein metabolism (3) (4) (5) (6) (7) (8) (9) (49). In rodent liver where PPAR{alpha} expression is the highest, fibrates induce the expression of the fatty acid transport protein (FATP), LPL, and several peroxisomal and mitochondrial fatty acid oxidation genes (5) (12) (49). In additon, fibrates decrease apoC-III gene expression (6) (7). These transcriptional events lead to increased hepatic uptake and metabolism of fatty acids and enhanced catabolism of TG-rich lipoproteins, which together may account for most of the TG-lowering effects of fibrates. There are few reports describing fibrate/PPAR{alpha} regulation of gene expression in human tissues. Rodent responses to fibrates differ from humans in several respects, possibly related to differences in relative tissue distribution of PPAR{alpha}. Although humans express significant amounts of PPAR{alpha} protein in liver, expression of the receptor is highest in skeletal muscle (15) (16) (17). Fibrates induce a peroxisome proliferation response in the livers of rodents that leads to hepatomegaly and hepatocarcinogenesis upon repeated exposure (10) (11). Humans and nonhuman primates appear to be resistant to this peroxisome proliferative effect (18) (19) (20) (21) (22) (23). Fibrates increase HDL-C levels in man by stimulating the production of its major protein constituents apoA-I and apoA-II (8) (9). Conversely, in rodents, fibrates tend to reduce plasma HDL-C levels and decrease the hepatic expression of apoA-I and apoA-II (8) (50). Our search for a nonrodent animal model more predictive of the human response to fibrate-type activators of PPAR{alpha} led us to explore the effects of fenofibrate in the spontaneously obese rhesus monkey.

Similar to its effects in man, chronic treatment of obese rhesus monkeys with fenofibrate markedly lowered serum TG and produced a favorable increase in HDL-C levels (Fig 4). The decrease in serum TG is likely to be mediated through increased LPL-mediated lipoprotein lipolysis linked, at least in part, to a reduction in serum apoC-III levels (Table 2). In addition, fenofibrate may inhibit the production of TG-rich lipoproteins, as suggested by the decrease in serum apoB-100 levels (Table 2). Whereas LDL-C was modestly reduced upon fenofibrate treatment, LDL particle size increased significantly, indicating a trend toward the formation of less atherogenic LDL particles (1) (2). These changes in particle size are in response to the alterations in apolipoprotein composition and lipid content.

Food intake, body weight, and plasma glucose were not affected by fenofibrate treatment in these normoglycemic subjects; however, plasma insulin levels were dose-dependently decreased with fenofibrate. Gemfibrozil and bezafibrate have been shown to improve insulin action and glucose tolerance in hyperlipidemic patients without significant effects on body weight (42) (43). Fibrates have been shown to reduce body weight gain and improve insulin sensitivity in several rodent models of obesity, diabetes, and insulin resistance (40) (41) (44) (45). These effects are thought to be mediated through the coupling of increased flux of free fatty acids from peripheral tissues to the liver with enhanced hepatic lipid catabolism. By comparison, the insulin-sensitizing effects of PPAR{gamma} agonists, manifested as a reduction in serum glucose, insulin, and TG and increased adipose tissue mass in rodents, reportedly result from free fatty acid flux from skeletal muscle to adipose tissue (reviewed in (12), (51)). For several reasons, we believe that the apparent improvement in insulin resistance observed in these obese rhesus monkeys was not due to activation of PPAR{gamma}. Fenofibrate exhibits at least a 10-fold selectivity for human PPAR{alpha} over human PPAR{gamma} as determined in PPAR-GAL4 chimeric transfection assays (30 vs. 300 µM for human PPAR{alpha} and PPAR{gamma}, respectively) (36). Considering the high degree of homology between the human and rhesus PPAR{alpha} sequences, it is expected that this subtype selectivity is preserved among the other two rhesus PPAR receptors. Furthermore, the exposure levels of fenofibrate measured at several time points during the study indicate that fenofibrate was not present at sufficient levels in the serum to fully activate PPAR{gamma} (Table 3).

The results of this study support the obese rhesus monkey as an excellent animal model for evaluating the effects of novel lipoprotein-modulating agents, particularly agents that affect serum TG and HDL-C.


  FOOTNOTES

2 Present address: Zen-Bio Company, Research Triangle Park, NC 27709. Back
3 Present address: Tularik Inc., San Francisco, CA 94080. Back


  ACKNOWLEDGMENTS

The authors would like to thank Theresa Alexander and Joe Haney for their excellent technical assistance, Jane Binz for performing the serum chemistry analyses, and Ken Batchelor, Jeff Cobb, and Elizabeth Sugg for their support for this study.

Manuscript received March 26, 2001; and in revised form June 21, 2001

Abbreviations: b.i.d., bis in die, twice daily; HDL-C, HDL cholesterol; LDL-C, LDL cholesterol; PPAR{alpha}, peroxisome proliferator-activated receptor-{alpha}; VLDL-C, VLDL cholesterol


  REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

  1. Fruchart, J. C., Brewer, H. B., Jr., Leitersdorf, E. 1998. Consensus for the use of fibrates in the treatment of dyslipoporteinemia and coronary heart disease. Am. J. Cardiol. 81:912-917[Medline].

  2. Rader, D. J., Haffner, S. M. 1999. Role of fibrates in the management of hypertriglyceridemia. Am. J. Cardiol. 83:30F-35F[Medline].

  3. Shepherd, J. 1993. Mechanism of action of fibrates.. Postgrad. Med. J. 69(Suppl. 1):S34-S41.

  4. Catapano, A. 1992. Mode of action of fibrates.. Pharmacol. Res. 4:331-340.

  5. Schoonjans, K., Peinado-Onsurbe, J., Lefebvre, A., Heyman, R., Briggs, M., Deeb, S., Staels, B., Auwerx, J. 1996. PPAR{alpha} and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J. 15:5336-5348[Medline].

  6. Staels, B., Ngoc, V., Kosykh, V., Saladin, R., Fruchart, J., Dallongeville, J., Auwerx, J. 1995. Fibrates downregulate apolipoprotein C-III expression independent of induction of peroxisomal acyl coenzyme A oxidase: a potential mechanism for the hypolipidemic action of fibrates. J. Clin. Invest. 95:705-712.

  7. Hertz, R., Bishara-Shieban, J., Bar-Tana, J. 1995. Mode of action of peroxisome proliferators as hypolipidemic drugs. Suppression of apolipoprotein C-III. J. Biol. Chem. 270:13470-13475[Abstract/Free Full Text].

  8. Berthou, L., Saladin, R., Yaqoob, P., Branellec, D., Calder, P., Fruchart, J., Denefle, P., Auwerx, J., Staels, B. 1995. Regulation of rat liver apolipoprotein A-I, apolipoprotein A-II, and acyl-coenzyme A oxidase gene expression by fibrates and dietary fatty acids. Eur. J. Biochem. 232:179-187[Medline].

  9. Staels, B., Auwerx, J. 1998. Regulation of apo A-I gene expression by fibrates. Atherosclerosis. 137:S19-S23.

  10. Reddy, J., Lalwani, N. 1983. Carcinogenesis by hepatic peroxisome proliferators: evaluation of the risk of hypolipidemic drugs and industrial plasticizers to humans. CRC Crit. Rev. Toxicol. 12:1-58.

  11. Lock, E., Mitchell, A., Elcombe, C. 1989. Biochemical mechanisms of induction of hepatic peroxisome proliferators: biological implications. Annu. Rev. Pharmacol. Toxicol. 19:145-163.

  12. Willson, T., Brown, P., Sternbach, D., Henke, B. 2000. The PPARs: from orphan receptors to drug discovery. J. Med. Chem. 43:527-550[Medline].

  13. Kliewer, S., Forman, B., Blumberg, B., Ong, E., Borgmeyer, U., Mangelsdorf, D., Umesono, K., Evans, R. 1994. Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc. Natl. Acad. Sci. USA. 91:7355-7359[Abstract/Free Full Text].

  14. Braissant, O., Foufelle, F., Scotto, C., Dauca, M., Wahli, W. 1996. Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-{alpha}, -ß, and -{gamma} in the adult rat. Endocrinology. 137:354-366[Abstract].

  15. Mukherjee, R., Jow, L., Noonan, D., McDonnell, D. 1994. Human and rat peroxisome proliferator activated receptors (PPARs) demonstrate similar tissue distribution but different responsiveness to PPAR activators. J. Steroid. Biochem. Mol. Biol. 51:157-166[Medline].

  16. Palmer, C., M-H. Hsu, K., Griffin, J., Raucy,, Johnson, E. 1998. Peroxisome proliferator activated receptor-{alpha} expression in human liver. Molec. Pharmacol. 53:14-22[Abstract/Free Full Text].

  17. Su, J-L., Simmons, C., Wisely, B., Ellis, B., Winegar, D. 1998. Monitoring of PPAR alpha protein expression in human tissue by the use of PPAR alpha-specific mAbs. Hybridoma. 17:47-53[Medline].

  18. Graham, M. J., Wilson, S. A., Winham, M. A., Spencer, A. J., Rees, J. A., Old, S. L., Bonner, F. W. 1994. Lack of peroxisome proliferation in marmoset liver following treatment with ciprofibrate for 3 years. Fundam. Appl. Toxicol. 22:58-64[Medline].

  19. Makowska, J. H., Gibson, G. G., Bonner, F. W. 1992. Species differences in ciprofibrate induction of hepatic cytochrome P450 4A1 and peroxisome proliferation. J. Biochem. Toxicol. 7:183-191[Medline].

  20. Blaauboer, B. J., vanHolsteijn, C. W. M., Bleumink, R., Mennes, W. C., vanPelt, F. N. A. M., Yap, S. H., vanPelt, J. F., vanIersel, A. A. J., Timmerman, A., Schmid, B. P. 1990. The effect of beclobric acid and clofibric acid on peroxisomal b-oxidation and peroxisome proliferation in primary cultures of rat, monkey and human hepatocytes. Biochem. Pharmacol. 40:521-528[Medline].

  21. Cornu-Chagnon, M. C., Dupont, H., Edgar, A. 1995. Fenofibrate: metabolism and species differences for peroxisome proliferation in cultured hepatocytes. Fundam. Appl. Toxicol. 26:63-74[Medline].

  22. Blumcke, S., Schwartzkopf, W., Lobeck, H., Edmondson, N. A., Prentice, D. E., Blane, G. F. 1983. Influence of fenofibrate on cellular and subcellular liver structure in hyperlipidemic patients. Atherosclerosis. 46:105-116[Medline].

  23. Bentley, P., Calder, I., Elcombe, C. R., Grasso, P., Stringer, D., Wiegand, H. J. 1993. Hepatic peroxisome proliferation in rodents and its significance for humans. Food Chem. Toxicol. 31:857-907[Medline].

  24. Rodney, G., Uhlendorf, P., Maxwell, R. E. 1976. The hypolipid-emic effect of gemfibrozil (CI-719) in laboratory animals. Proc. Royal Soc. Med. 69:6-10.

  25. Younger, R. K., Curtis, J. J., Butts, W. H., Scott, H. W. 1976. Protective effect of ileal bypass versus administration of clofibrate on experimental hypercholesterolemia and atherosclerosis in monkeys. S. Afr. Med. J. 69:1141-1145.

  26. Ramharack, R., Spahr, M. A., Hicks, G. W., Kieft, K. A., Brammer, D. W., Minton, L. L., Newton, R. S. 1995. Gemfibrozil significantly lowers cynomolgus monkey plasma lipoprotein[a]-protein and liver apolipoprotein[a] mRNA levels. J. Lipid Res. 36:1294-1304[Abstract].

  27. Weingand, K. W. 1989. Atherosclerosis research in cynomolgus monkeys. Macaca fascicularis Exp.(Mol. Pathol. 50):1-15.

  28. Strong, J. P., Bhattacharyya, A. K., Eggen, D. A., Malcom, G. T., Newman, W. P., III, Restrepo, C. R. 1994. Long-term induction and regression of diet-induced atherosclerotic lesions in rhesus monkeys. Arterioscler. Thromb. 14:958-965[Abstract/Free Full Text].

  29. Masuda, J., Ross, R. 1990. Atherogenesis during low level hypercholesterolemia in the nonhuman primate. Arteriosclerosis. 10:164-187[Abstract/Free Full Text].

  30. Semenkovich, C. F., Heinecke, J. W. 1997. The mystery of diabetes and atherosclerosis: time for a new plot. Diabetes. 46:327-334[Abstract].

  31. Kreisberg, R. A. 1998. Diabetic dyslipidemia. Am. J. Cardiol. 82:67U-73U[Medline].

  32. Watts, G. F., Dimmitt, S. B. 1999. Fibrates, dyslipoproteinaemia and cardiovascular disease. Curr. Opin. Lipidol. 10:561-574[Medline].

  33. Hannah, J. S., Verdery, R. B., Bodkin, N. L., Hansen, B. C., Le, N., Howard, B. V. 1991. Changes in lipoprotein concentrations during the development of noninsulin-dependent diabetes mellitus in obese rhesus monkeys. J. Clin. Endocrinol. Metab. 72:1067-1072[Abstract].

  34. Hansen, B. C. 1987. Prospective study of the development of diabetes in spontaneously obese rhesus monkeys. In Recent Advances in Obesity Research. E. M. Berry, S. H. Blondheim, H. E. Eliahou, and E. Shafrir, editors. John Libbey, London. 33–41.

  35. Bodkin, N. L., Metzger, B. L., Hansen, B. C. 1989. Sequential changes in hepatic glucose production and insulin sensitivity during the development of noninsulin-dependent diabetes mellitus in monkeys. Am. J. Physiol. 256:E676-E681[Abstract/Free Full Text].

  36. Brown, P., Winegar, D., Plunket, K., Moore, L., Lewis, M., Wilson, J., Sundseth, S., Koble, C., Wu, Z., Chapman, J., Lehmann, J., Kliewer, S., Willson, T. 1999. A ureido-thioisobutyric acid (GW9578) is a subtype-selective PPAR{alpha} agonist with potent lipid-lowering activity. J. Med. Chem. 42:3785-3788[Medline].

  37. Lehman, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., Kliewer, S. A. 1995. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J. Biol. Chem. 270:12953-12956[Abstract/Free Full Text].

  38. Adkins, J. C., Faulds, D. 1997. Micronised fenofibrate: a review of its pharmacodynamic properties and clinical efficacy in the management of dyslipidaemia. Drugs. 54:615-633[Medline].

  39. Verdery, R. B., Ingram, D. K., Roth, G. S., Lane, M. A. 1997. Caloric restriction increases HDL2 levels in rhesus monkeys (Macaca mulatta). Am. J. Physiol. 273:E714-E719[Abstract/Free Full Text].

  40. Guerre-Millo, M., Gervois, P., Raspe, E., Madsen, L., Poulain, P., Derudas, B., J-M. Herbert, D., Winegar, T., Willson, J., Fruchart, R., Berge,, Staels, B. 2000. PPAR{alpha} activators improve insulin sensitivity and reduce adiposity. J. Biol. Chem. 275:16638-16642[Abstract/Free Full Text].

  41. Matsui, H., Okumura, K., Kawakami, K., Hibino, M., Toki, Y., Ito, T. 1997. Improved insulin sensitivity by bezafibrate in rats: relationship to fatty acid composition of skeletal-muscle triglycerides. Diabetes. 46:348-353[Abstract].

  42. Inoue, I., Takahashi, K., Katayama, S., Akabane, S., Negishi, K., Suzuki, M., Ishii, J., Kawazu, S. 1994. Improvement of glucose tolerance by bezafibrate in non-obese patients with hyperlipidemia and impaired glucose tolerance. Diabetes Res. Clin. Prac. 25:199-205[Medline].

  43. Avogaro, A., Beltramello, P., Marin, R., Zambon, S., Bonanome, A., Biffanti, S., Confortin, L., Manzato, E., Crepaldi, G., Tiengo, A. 1995. Insulin action and glucose metabolism are improved by gemfibrozil treatment in hypertriglyceridemic patients. Atherosclerosis. 113:117-124[Medline].

  44. Chaput, E., Saladin, R., Silvestre, M., Edgar, A. D. 2000. Fenofibrate and rosiglitazone lower serum triglycerides with opposing effects on body weight. Biochem. Biophys. Res. Commun. 271:445-450[Medline].

  45. Mancini, F. P., Lanni, A., Sabatino, L., Moreno, M., Giannino, A., Contaldo, F., Colantuoni, V., Goglia, F. 2001. Fenofibrate prevents and reduces body weight gain and adiposity in diet-induced obese rats. FEBS Lett. 491:154-158[Medline].

  46. Austin, M. A., Hokanson, J. E., Edwards, K. L. 1998. Hypertriglyceridemia as a cardiovascular risk factor. Am. J. Cardiol. 81:7B-12B[Medline].

  47. Kesaniemi, Y. A. 1998. Serum triglycerides and clinical benefit in lipid-lowering trials. Am. J. Cardiol. 81:70B-73B[Medline].

  48. Hodis, H. N., Mack, W. J. 1998. Triglyceride-rich lipoproteins and progression of atherosclerosis. Eur. Heart J. 19:A40-A44.

  49. Staels, B., Auwerx, J. 1997. Role of PPAR in the pharmacological regulation of lipoprotein metabolism by fibrates and thiazolidinediones. Curr. Pharmaceutical Design. 3:1-14.

  50. Berthou, L., Duverger, N., Emmanuel, F., Langouet, S., Auwerx, J., Guillouzo, A., Fruchart, J., Rubin, E., Denefle, P., Staels, B., Branellec, D. 1996. Opposite regulation of human versus mouse apolipoprotein A-I by fibrates in human apolipoprotein A-I transgenic mice. J. Clin. Invest. 97:2408-2416[Medline].

  51. Grossman, S., Lessem, J. 1997. Mechanisms and clinical effects of thiazolidinediones. Exp. Opin. Invest. Drugs. 6:156-162.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Tsunoda, N. Kobayashi, T. Ide, M. Utsumi, M. Nagasawa, and K. Murakami
A novel PPAR{alpha} agonist ameliorates insulin resistance in dogs fed a high-fat diet
Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E833 - E840.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Kharitonenkov, V. J. Wroblewski, A. Koester, Y.-F. Chen, C. K. Clutinger, X. T. Tigno, B. C. Hansen, A. B. Shanafelt, and G. J. Etgen
The Metabolic State of Diabetic Monkeys Is Regulated by Fibroblast Growth Factor-21
Endocrinology, February 1, 2007; 148(2): 774 - 781.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. Serisier, F. Briand, K. Ouguerram, B. Siliart, T. Magot, and P. Nguyen
Fenofibrate Lowers Lipid Parameters in Obese Dogs
J. Nutr., July 1, 2006; 136(7): 2037S - 2040S.
[Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. P. Singh, R. Kauffman, W. Bensch, G. Wang, P. McClelland, J. Bean, C. Montrose, N. Mantlo, and A. Wagle
Identification of a Novel Selective Peroxisome Proliferator-Activated Receptor {alpha} Agonist, 2-Methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic Acid (LY518674), That Produces Marked Changes in Serum Lipids and Apolipoprotein A-1 Expression
Mol. Pharmacol., September 1, 2005; 68(3): 763 - 768.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Reifel-Miller, K. Otto, E. Hawkins, R. Barr, W. R. Bensch, C. Bull, S. Dana, K. Klausing, J.-A. Martin, R. Rafaeloff-Phail, et al.
A Peroxisome Proliferator-Activated Receptor {alpha}/{gamma} Dual Agonist with a Unique in Vitro Profile and Potent Glucose and Lipid Effects in Rodent Models of Type 2 Diabetes and Dyslipidemia
Mol. Endocrinol., June 1, 2005; 19(6): 1593 - 1605.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H. K. Ortmeyer, Y. Adall, K. R. Marciani, A. Katsiaras, A. S. Ryan, N. L. Bodkin, and B. C. Hansen
Skeletal muscle glycogen synthase subcellular localization: effects of insulin and PPAR-{alpha} agonist (K-111) administration in rhesus monkeys
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1509 - R1517.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. M. Wallace, M. Schwarz, P. Coward, J. Houze, J. K. Sawyer, K. L. Kelley, A. Chai, and L. L. Rudel
Effects of peroxisome proliferator-activated receptor {alpha}/{delta} agonists on HDL-cholesterol in vervet monkeys
J. Lipid Res., May 1, 2005; 46(5): 1009 - 1016.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Guzman, J. Lo Verme, J. Fu, F. Oveisi, C. Blazquez, and D. Piomelli
Oleoylethanolamide Stimulates Lipolysis by Activating the Nuclear Receptor Peroxisome Proliferator-activated Receptor {alpha} (PPAR-{alpha})
J. Biol. Chem., July 2, 2004; 279(27): 27849 - 27854.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Prieur, H. Coste, and J. C. Rodriguez
The Human Apolipoprotein AV Gene Is Regulated by Peroxisome Proliferator-activated Receptor-{alpha} and Contains a Novel Farnesoid X-activated Receptor Response Element
J. Biol. Chem., July 3, 2003; 278(28): 25468 - 25480.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. L. Brand, J. Sturis, C. F. Gotfredsen, J. Fleckner, C. Fledelius, B. F. Hansen, B. Andersen, J.-M. Ye, P. Sauerberg, and K. Wassermann
Dual PPARalpha /gamma activation provides enhanced improvement of insulin sensitivity and glycemic control in ZDF rats
Am J Physiol Endocrinol Metab, April 1, 2003; 284(4): E841 - E854.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Coste and J. C. Rodriguez
Orphan Nuclear Hormone Receptor Rev-erbalpha Regulates the Human Apolipoprotein CIII Promoter
J. Biol. Chem., July 19, 2002; 277(30): 27120 - 27129.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Winegar, D. A.
Right arrow Articles by Hansen, B. C.