|
Journal of Lipid Research, Vol. 42, 1789-1800, November 2001
Copyright © 2001 by Lipid Research, Inc.
Regulation of human apolipoprotein A-I gene expression by equine estrogens
Xia Zhanga,b,
Jei-Jun Jiaob,
Bhagu R. Bhavnanic, and
Shui-Pang Tama,b
a Department of Biochemistry, Queen's University, Kingston, Ontario, Canada
b Cancer Research Laboratories, Queen's University, Kingston, Ontario, Canada
c Department of Obstetrics and Gynecology, Institute of Medical Sciences, University of Toronto and St. Michael's Hospital, Toronto, Ontario, Canada
Correspondence to:
Shui-Pang Tam, at Department of Biochemistry, Cancer Research Laboratories, Third Floor, Botterell Hall Queens University, Kingston, Ontario, Canada K7L 3N6., tamsp{at}post.queensu.ca (E-mail)
 |
ABSTRACT |
|---|
Estrogen replacement therapies, such as conjugated equine estrogen (CEE, Premarin®), reduce the risk of coronary heart disease among postmenopausal women. In the present study, a HepG2 stable cell line (HepG2/S) that harbors a luciferase reporter gene cassette with the human apolipoprotein A-I (apoA-I) promoter region was used to examine the activity of CEE components in modulating human apoA-I promoter activity. A number of estrogens modulated apoA-I promoter activity, with equilenin (Eqn) being the most potent. Eqn produced a 3-fold increase in apoA-I promoter activity and a similar increase in apoA-I mRNA without affecting its degradation rate. Nuclear runoff assays indicated that the transcription rate of the apoA-I gene was increased 2.5-fold in Eqn-treated cells. When HepG2/S cells were exposed to Eqn, apoA-I protein secretion increased by 80%, whereas the level of secreted apoA-II remained unchanged. Transient transfection studies with human apoA-I promoter constructs derived from pGL3-luciferase reporter plasmid were used to identify the cis-acting element involved in Eqn-mediated induction. The results demonstrated that the apoA-I electrophile/antioxidant response element (EpRE/ARE) might be responsible for the increase in apoA-I promoter activity by Eqn. Cotransfection experiments using estrogen receptor (ER and/or ERß) expression vectors have indicated that neither receptor can potentiate the Eqn-mediated induction of apoA-I promoter activity. In addition, mobility shift analysis using antibody against either ER or ERß cannot detect the presence of these receptors in the DNA-protein complex.
The data indicate that Eqn can induce the promoter activity of the human apoA-I gene, leading to an increase in apoA-I mRNA levels and apoA-I protein secretion through an ER-independent pathway involving apoA-I EpRE/ARE. Zhang, X., J-J. Jiao, B. R. Bhavnani, and S-P. Tam. Regulation of human apolipoprotein A-I gene expression by equine estrogens. J. Lipid Res. 2001. 42: 17891800.
Supplementary key words:
apolipoprotein A-I, estrogen replacement therapy, gene regulation, HDL
 |
INTRODUCTION |
|---|
Coronary heart disease (CHD) is the major cause of morbidity and mortality in postmenopausal women (1) (2). Elevated levels of LDL cholesterol and low levels of HDL cholesterol and apolipoprotein A-I (apoA-I) are important risk factors for atherogenesis (3) (4) (5). Observational studies have found that estrogen replacement therapy in postmenopausal women significantly lowers the risk of CHD (6) (7). A large prospective randomized study, the Postmenopausal Estrogen/Progestin Intervention (PEPI) trial, has found that estrogen increased levels of HDL cholesterol and lowered levels of LDL cholesterol (8). In addition, the PEPI trial has indicated that inclusion of progesterone or medroxyprogesterone acetate in treatment regimens attenuated the beneficial effects of estrogens (8). The PEPI investigators have now extended these observations and reported that postmenopausal estrogen therapy, with or without concomitant progestin regimens, resulted in lower plasma lipoprotein [a] levels (9). In contrast to these findings, the Heart and Estrogen/Progestin Replacement Study (HERS), of postmenopausal women with existing CHD, found that although the lipid levels improved and lipoprotein [a] concentrations decreased, hormone treatment did not decrease the risk of CHD or CHD-related deaths at least during the first year of therapy (10). However, a beneficial effect (decrease of CHD events) was observed over time. These investigators further recommend that women receiving hormone replacement therapy continue to take it for primary prevention (10). Several mechanisms by which estrogens exert their protective effect have been proposed (7) (11) (12).
Some of the cardioprotective effects of estrogen replacement therapy appear to involve changes in lipids and lipoproteins, such as an increase in levels of HDL cholesterol and apoA-I, and a decrease in LDL cholesterol (7) (13) (14). HDL cholesterol and its major protein, apoA-I, have a number of antiatherogenic properties, such as reverse cholesterol transport (15) (16), inhibition of Cu2+ or endothelial cell-induced oxidation of LDL cholesterol (17), and inhibition of the proatherogenic activity of oxidized LDL (18), which is thought to play an important role in atherogenesis (19). Furthermore, transgenic mice expressing high amounts of human apoA-I are protected from the development of fatty streak lesions after being given high fat diets (20), indicating that apoA-I can play an important role in the prevention of atherogenesis.
Because the levels of plasma apoA-I are proportional to the level of apoA-I mRNA in vivo, the factors influencing levels of apoA-I may be mediated through the level of apoA-I gene expression. The cis- and trans-acting elements participating in apoA-I gene transcription have been extensively studied (21) (22) (23) (24) (25). The DNA region located between nucleotide base pair -256 and -41 upstream from the transcription initiation site of the human apoA-I gene contains the regulatory elements necessary for maximal expression in human hepatoma cell line G2 (HepG2) (23). The mechanisms by which estrogens exert their cardioprotective effects are not known. Exposure of HepG2 cells to 17ß-estradiol (17ß-E2) results in changes in the apoA-I transcription rate (26); these changes are mediated by interaction of estrogen receptor (ER ) and other transcription factors with the apoA-I promoter region (25). However, the human apoA-I promoter does not contain the classic estrogen response element (ERE), suggesting that the induction of apoA-I transcription may act through other cis-acting elements. Estrogens and some of their metabolites can also act as electrophile/redox-active factors that may possibly regulate genes through electrophile/antioxidant response elements (EpRE/ARE) (27) (28) (29). The presence of EpRE/ARE in the promoter region of human apoA-I gene has been demonstrated and compounds such as gramoxone and dimethyl sulfoxide appear to regulate the expression of human apoA-I gene via these response elements (24) (30).
Estrogens exhibit various effects (31) (32) (33) (34) (35) and although they are able to increase the levels of HDL cholesterol and apoA-I (7) (14), the mechanism by which estrogens influence the expression of apoA-I gene has not been fully described. In the present investigation, we examined the effects of various equine estrogens on apoA-I promoter activity, using a stable HepG2 cell line (HepG2/S) that permanently harbors a gene cassette containing 256 bp of the 5'-flanking region of a human apoA-I gene fused to the luciferase (luc) gene. We also studied the potential involvement of ER in the regulation of human apoA-I gene expression. The estrogens tested were the 10 biologically active components of conjugated equine estrogen (CEE) (Premarin®; Wyeth-Ayerst, Philadelphia, PA), the most commonly used estrogen for estrogen and hormone replacement therapy in postmenopausal women (34).
 |
MATERIALS AND METHODS |
|---|
Oligonucleotides
The following oligonucleotides and their complementary strands were synthesized [Beckman (Fullerton, CA) Oligo 1000 DNA synthesizer]: apoA-I(-41/+7), 5'-CTGAGATGGCTGCA GACATAAATAGGCCCTGCAAGAGCTGGCTGCTTAGAGACT AAGCTT-3'; apoA-I-EpRE/ARE, 5'-GAGCTCTTGCCCAGCCCC AGGGACAGAGCTGATCGCTAGCC-3'; apoA-I-mEpRE/mARE, 5'-AGCTCTTGCCCAGCCCCATTTGAGTGTATGATCGCTAG CC-3'; Xenopus vitellogenin A2 ERE, 5'-GCTCCAAAGTCAGGTCA CAGTGACCTGATCGCTAGCC-3'.
Cell culture
The HepG2 cell line and the human breast adenocarcinoma cell line (MCF-7) were obtained from the American Type Culture Collection (Rockville, MD). HepG2 cells were cultured in MEM supplemented with 10% FBS as described previously (35). HepG2 cells that were stably transfected with the apoA-I promoter and luciferase reporter gene cassette (HepG2/S) were also grown in MEM supplemented with 10% FBS (36). Seven days before the experiments, cells were grown in phenol red-free and estrogen-depleted medium supplemented with 10% charcoal-treated FBS (CTFBS). MCF-7 cells were maintained in MEM plus phenol red supplemented with nonessential amino acids, 10% FBS, and 10 nM estradiol. Two weeks before the experiments, MCF-7 cells were grown for 2 days in MEM containing phenol red and 5% CTFBS. Cells were then grown in phenol red-free MEM supplemented with nonessential amino acids and 5% CTFBS for 7 days. Cells used in all experiments were in the log phase of growth and were at about 60% of confluence. Cell viability was routinely monitored by trypan blue exclusion and lactate dehydrogenase leakage as describe previously (37). In all experiments the number of dead cells never exceeded 5% of the total number of cells.
Plasmids
The pGL3-apoA-I(-41/+7)-luc construct was created by inserting a double-stranded oligonucleotide that contained XhoI and HindIII restriction sites at the 5' end and 3' end of the DNA element, respectively, and DNA sequence corresponding to base pairs -41 to +7 of the human apoA-I promoter (5'-TGGCTGCA GACATAAATAGGCCCTGCAAGAGCTGGCTGCTTAGAGACT-3') into XhoI and HindIII sites in pGL3-Basic (Promega, Madison, WI). The pGL3-apoA-I-EpRE/ARE(-41/+7)-luc construct was generated by cloning a double-stranded oligonucleotide that had SacI and NheI restriction sites at the 5' end and 3' end, respectively, and DNA sequence corresponding to base pairs -153 to -126 of the human apoA-I promoter (apoA-I-EpRE/ARE, 5'-TTGCCCAGCCCCAGGGACAGAGCTGATC-3') into their respective sites in the pGL3-apoA-I(-41/+7)-luc construct. The pGL3-apoA-I-mEpRE/mARE(-41/+7) construct was created by inserting a double-stranded oligonucleotide that contained SacI and NheI restriction sites at the 5' end and 3' end, respectively, and a mutated sequence related to DNA sequence corresponding to base pairs -153 to -126 of the human apoA-I promoter (apoA-I-mEpRE/mARE, 5'-TTGCCCAGCCCCATTTGAGTG TATGATC-3') into their respective sites in the pGL3-apoA-I(-41/+7)-luc construct. The pGL3-apoA-I(-249/+7)-luc construct was generated by PCR by using the pGL2-apoA-I(-249/+1)-luc vector as described previously (37). Primer A (5'-GCTAGC CCGGGAGACCTGCAAGCCTGCA-3') contained a sequence corresponding to the coding strand sequence of the apoA-I promoter from base pair -250 to base pair - 228 and restriction sites of NheI and XmaI/SmaI. Primer B (5'-CGCAGATCTAGT CACTAAGCAGCCAGCTCTTGCAGGGCCT-3') contained a sequence corresponding to the noncoding strand sequence of the apoA-I promoter from base pair -24 to base pair +7 and the BglII restriction site. Amplification was carried out in an Eppendorf MicroCycler E for 30 cycles according to a procedure described previously (37). The PCR-generated fragment was digested with NheI and BglII, and the resulting DNA fragment was gel purified. The purified DNA fragment was cloned into the NheI and BglII sites of pGL3-Basic (Promega) and used to transform competent DH5 cells. The procedure for generating pGL3-apoA-I(-249/+7)mEpRE/mARE-luc was similar to the construction of pGL3-apoA-I(-249/+7), except that pGL2-apoA-I(-249/+1)mEpRE/mARE-luc was used as the PCR template instead. The pGL3-apoA-I(-117/+7)-luc construct was created by deleting a small DNA fragment from the pGL3-apoA-I(-249/+7)-luc construct, using restriction enzymes SmaI and AflII followed by religation of the larger fragment. The pGL3-tk-luc construct was generated by cloning a DNA fragment that was digested from the pGL2-tk-luc construct at SmaI and HindIII sites into their respective sites in pGL3-Basic (Promega) (37). To generate pGL3-apoA-I-EpRE/ARE-tk-luc and pGL3-apoA-I-mEpRE/mARE-luc constructs, the double-stranded apoA-I-EpRE/ARE and apoA-I-mEpRE/mARE oligonucleotides that contained SacI and NheI sites at the 5' end and 3' end of the DNA fragments, respectively, were cloned into their respective sites in the pGL3-tk-luc construct. pGL3-vitERE-luc was constructed by inserting double-stranded X. vitellogenin A2 ERE oligonucleotides that contained SacI and NheI sites at the 5' end and 3' end of the DNA fragments, respectively. These fragments were cloned into their respective sites in the pGL3-tk-luc construct. The human ER expression vectors HEGO (wild-type ER ) and HEO (ER variant), and the human ERß expression vector, were kindly provided by T. S. Scanlan (Department of Pharmaceutical Chemistry, University of California, San Francisco, CA).
Construction of pEBV7-apoA-I(-249/+7)-luc expression vector and establishment of stable cell line HepG2/S
The pEBV7-apoA-I(-249/+7)-luc expression vector was created by using pEBV7 and pGL3-apoA-I(-249/+7)-luc constructs according to the procedure described previously (37). HepG2/S cell lines were prepared by transfecting the pEBV7-apoA-I(-249/+7)-luc expression vector that was previously linearized with SacI into HepG2 cells by a standard calcium phosphate precipitation method. After overnight incubation with the calcium phosphate-DNA precipitate, the cells were washed twice with PBS and maintained in MEM plus 10% FBS for 48 h. Stable expression cells were selected by resistance to hygromycin B (300 µg/ml) (Boehringer Mannheim, Indianapolis, IN). After 2 weeks, the isolated colonies of surviving cells were selected and subcultured at low density and exposed to another round of clonal isolation. The HepG2/S cell line was used in these experiments and the cells were propagated over 8 months without losing luciferase activity or hygromycin resistance.
Screening procedures for various estrogens
The stably transfected HepG2/S cell line was routinely maintained as monolayers in 75-cm2 flasks. When the cells reached 70% confluence, they were subcultured in 24-well tissue culture plates and grown as monolayer in phenol red-free MEM supplemented with 10% CTFBS. After 2 days, the cells were treated with either vehicle (ethanol) or estrogens at various concentrations and time periods (indicated in the figure legends). Treated cells were then washed with PBS three times; the cells were lysed with a passive-lysis buffer (Promega). Firefly luciferase activity was determined by using an EG&G Berthold (Salem, MA) microplate luminometer LB96V. The protein concentration of luciferase reaction solution was determined with a Bio-Rad (Hercules, CA) protein assay kit and the luciferase activity was normalized for protein concentration.
RNA isolation and Northern analysis
Total cellular RNA was isolated from HepG2/S cells by the acid guanidinium thiocyanate-phenol-chloroform extraction method as described previously (36). For Northern analysis, 20 µg of total RNA was denatured by treatment with glyoxal and subjected to electrophoresis on a 1.5% agarose gel, and then transferred to Zeta-probe GT membrane (Bio-Rad) as described previously (36). The blots were then prehybridized and hybridized with 32P-labeled human apoA-I cDNA. The relative intensities of the hybridized signals and ethidium bromide-stained 28S and 18S rRNA were quantitated by PhosphorImaging analysis software (Molecular Dynamics, Sunnyvale, CA). All results were then normalized to the 28S and 18 S rRNA signals.
Immunoprecipitation assays
Preswollen protein G-agarose (Boehringer Mannheim) was washed twice with PBS containing 0.5% Triton and 0.2% SDS and recovered by centrifugation for 20 s at 12,000 g. Monolayers of HepG2/S cells were washed twice with 10 ml of serum-free DMEM and incubated with 5 ml of methionine-free DMEM (without serum) supplemented with [35S]methionine (500 µCi, 1,100 Ci/mmol) in the absence or presence of estrogens. At the indicated times, the medium was collected and transferred to a tube containing a protease inhibitor mixture and centrifuged at 1,500 g for 5 min to remove any dead cells and debris as described previously (30). Before immunoprecipitation, the supernatants were incubated with a protein G-agarose suspension overnight at 4°C. The mixtures were then centrifuged for 20 s at 12,000 g and the supernatants were transferred to a fresh tube. An aliquot (20 µl) of supernatant was used for determination of protein concentration. Another aliquot (100 µl) of the supernatant was used for immunoprecipitation of human apoA-I, apoE, and apoA-II. Specific polyclonal antibodies against these apolipoproteins (Boehringer Mannheim) were used for immunoprecipitation. The reaction mixtures were incubated overnight at 4°C and the immunocomplexes were precipitated by further incubation with prewashed protein G-agarose beads overnight at 4°C. Immunoprecipitates were collected by centrifugation and washed three times with 200 µl of PBS containing 0.5% Triton X-100 and 0.2% SDS. The final washed precipitates were resuspended in 100 µl of SDS-gel loading buffer and boiled for 5 min. After centrifugation, an aliquot of each supernatant was taken for scintillation counting and another portion was subjected to 12% SDS-polyacrylamide gel electrophoresis. To determine the radioactivity in the precipitated proteins, the relevant band was localized after fluorography, cut out of the dry gel, digested, and counted as described previously (30).
Preparation of nuclear extracts and gel mobility shift and supershift assays
Nuclear extract preparation and gel mobility shift assays have been described previously (37). For supershift assays, nuclear extracts were preincubated with specific antibody against human ER or ERß (Santa Cruz Biotechnology, Santa Cruz, CA) at 4°C from 45 min to overnight and then incubated with 32P-labeled double-stranded oligonucleotides for 30 min. The resulting complex and free DNA were resolved on a 5% nondenaturing polyacrylamide gel. Gels were vacuum dried on 3MM Whatman (Clifton, NJ) paper and exposed to a PhosphorImage catching screen and then analyzed by a PhosphorImaging system (Molecular Dynamics).
Nuclear runoff transcription assay
Nuclei were prepared according to the method of Bartalena and co-workers (38). An in vitro nuclear runoff transcription assay was carried out as described (38) with minor modifications (39). The procedure for nuclear runoff experiments has been described in detail previously (37).
Transient transfection and luciferase assays
HepG2 cells were transfected in 12-well plates by using a 1-µg/well concentration of reporter gene and 20 ng of ER expression vector. MCF-7 cells were transfected in six-well plates by using 2 µg of reporter gene per well. In all transfections, an internal control plasmid, pRL-TK or pRL-null, was included in order to correct for differences in transfection and harvesting efficiency. Transient DNA transfections were performed according to the FuGENE 6TM procedure (Boehringer Mannheim). The cells were then cultured in estrogen-depleted MEM in the presence of either vehicle (ethanol) or estrogens at various concentrations and periods of time, as indicated in the figure legends. Transfected cells were washed three times in PBS and then harvested with passive-lysis buffer. Both firefly luciferase and Renilla luciferase activities were measured with an EG&G Berthold microplate luminometer LB96V, according to the procedures of the dual-luciferase assay (Promega).
Data analysis
Each incubation was performed four times and the mean value for each of the estrogens on a plate was expressed as a percentage/fold of the change relative to the controls on the same plate. For each of the estrogens, six values were obtained in separate experiments on different days. Statistical analyses were performed with the SAS statistical package and GraphPad 2.01 on a PC computer. An unpaired t-test or one-way ANOVA was used to evaluate the effect of compounds on the percentage/fold changes from the control samples. Dunnett's test was used to compare each treatment group with the control group when the percentage/fold change was not monotonic across the treatments. The Student-Newman-Keuls test was used to compare pairs of all treatment groups.
 |
RESULTS |
|---|
Establishment of HepG2/S cell line
Changes of apoA-I gene transcription can be achieved in hepatoma cells by environmental stimuli such as with certain compounds; these changes can be determined by monitoring luciferase or chloramphenicol acetyltransferase reporter constructs with an upstream apoA-I promoter in these cells. However, all of these experiments were carried out under transient transfection conditions, in which the consideration of chromatin structure was ignored. Furthermore, the whole process was labor intensive and the results were influenced by the transfection efficiency among the experiments. To mimic in vivo conditions more closely and facilitate the process of screening various compounds, we established a HepG2 cell line stably transfected with a luciferase construct, which harbors a luciferase reporter cassette reporter with an upstream human apoA-I promoter region containing base pairs -249 to +7 of 5'-flanking sequence. The construct was linearized before being transfected into the parent cell line. Therefore, the construct had been integrated in the chromosome. This permanently transfected cell line was named HepG2/S.
Effects of estrogens on human apoA-I promoter activity
The effects of various estrogens on human apoA-I promoter activity were determined in HepG2/S cells. Although these estrogens are related structurally, differential effects on apoA-I gene transcription in HepG2/S cells were observed ( Fig 1). The estrogens equilin (Eq), 17ß-equilin (17ß-Eq), equilenin (Eqn), and 17ß-equilenin (17ß-Eqn) significantly (P < 0.05) increased the luciferase activity of this apoA-I promoter-containing cassette. Estrone (E1), 17ß-estradiol (17ß-E2), 17 -estradiol (17 -E2), 17 -equilin (17 -Eq), 17 -equilenin (17 -Eqn), and -8-estrone ( 8-E1) had no significant effect. Of the four active estrogens, Eqn was the most potent and it stimulated the apoA-I promoter activity 2- to 3-fold (Fig 1) compared with the vehicle-treated control sample. The relative potencies had the following order: Eqn > 17ß-Eqn > Eq = 17ß-Eq.
Pharmacokinetics of stimulation of apoA-I promoter activity by Eqn
Because Eqn was the most potent stimulator of apoA-I promoter activity; all further work was carried out with this estrogen only. The effect of Eqn on the apoA-I transcription rate was determined ( Fig 2). apoA-I promoter activity increased with increasing concentration of Eqn and the maximum stimulatory effect of Eqn was observed at 10 µM (Fig 2A). This effect was also time dependent and maximal activity at all concentrations was seen at approximately 24 h (Fig 2B). After 2 h of exposure to Eqn, apoA-I promoter activity increased by 20% over the control value; between 16 and 24 h it increased by approximately 300%. After 24 h, the stimulatory effect gradually decreased but remained above the control value for up to 48 h.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2.
Dose-response and kinetic studies of Eqn-mediated induction of luciferase activity in HepG2/S cells. Cells were treated with various concentrations of Eqn and harvested at the indicated time points. Cytosolic extracts were assayed for luciferase activities and protein concentrations. The normalized value of the cells treated with ethanol (65,893 ± 432 RLU/µg of protein) was arbitrarily set at 100%. Results represent the means ± SEM of six independent experiments. A: Concentration-dependent profile. B: Time-dependent profile.
|
|
Effect of Eqn on apoA-I mRNA levels and apolipoprotein levels
The apoA-I mRNA level after Eqn treatment was monitored by Northern blot analysis. Exposure of HepG2/S cells to Eqn resulted in a 2- to 3-fold increase in apoA-I mRNA levels ( Fig 3). To determine whether inhibition of RNA synthesis influences the induction of apoA-I mRNA levels, HepG2/S cells were treated both in the absence and presence of increasing amounts of actinomycin D for 30 min before the addition of Eqn (10 µM). Actinomycin D at concentrations 1 µg/ml inhibited the increase in apoA-I mRNA levels when the cells were treated with Eqn (data not shown). To determine whether mRNA stabilization is responsible for the observed induction of apoA-I mRNA levels caused by Eqn, the half-lives for apoA-I mRNA were measured in the presence of actinomycin D (1 µg/ml) with and without Eqn treatment. HepG2/S cells were pretreated with Eqn (10 µM) or ethanol (drug vehicle) for 24 h. Cells were then cultured for additional periods ranging from 0 to 24 h in the presence of actinomycin D. The degradation rate of apoA-I mRNAs after the addition of actinomycin D with or without Eqn was approximately the same (Fig 3). The apparent half-lives were 14.6 ± 0.3 and 14.8 ± 0.2 h, respectively; these results were not significantly different.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 3.
Effect of Eqn on the level and half-life of apoA-I mRNA. Cells were cultured without or with Eqn (10 µM) for 24 h in MEM minus phenol red and supplemented with 10% CTFBS. Cells were then cultured for additional periods ranging from 0 to 24 h in the presence of actinomycin D (1 µg/ml). Total RNA was isolated at the indicated time points and then was separated by 1.5% agarose gel electrophoresis. ApoA-I mRNA was determined by Northern analysis (top). The relative intensities of the hybridized apoA-I mRNA signal and ethidium bromide-stained 28S rRNA were quantitated by PhosphorImager analyses. All results were normalized with ethidium bromide-stained 28S rRNA to correct for loading variations. The normalized apoA-I mRNA levels, in arbitrary units, are presented on a log scale. The half-lives for the apoA-I mRNAs were obtained from the first-order decay calculation. Solid circles and solid squares represent RNA samples isolated from cells treated without and with Eqn, respectively. Results represent means ± SEM of four experiments. An unpaired t-test was used to compare the half-life of the Eqn-treated group with that of the drug-vehicle-treated group.
|
|
The de novo synthesis of apolipoproteins by HepG2/S cells after exposure of the cells to Eqn was determined by measuring the incorporation of radiolabeled methionine into apolipoproteins secreted into the medium. The rates of accumulation of secreted apoA-I, apoA-II, and apoE were determined at various time intervals after Eqn treatment. ApoA-I and apoE production increased by 80% and 50%, respectively, in Eqn-treated cells compared with vehicle-treated cells ( Fig 4). In contrast, no significant effect of Eqn on apoA-II secretion was observed. These results indicated that the effect of Eqn on production of apoA-I and apoE was quite specific. Eqn may not stimulate all major types of apolipoproteins found in HDL cholesterol.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 4.
Effect of Eqn on the kinetics of apoA-I, apoA-II, and apoE secretion by HepG2/S cells. HepG2/S cells were grown in 6-well tissue culture plates (approximately 106 cells/well). Cells were washed twice with 5 ml of PBS and cultured in serum- and methionine-free MEM plus [35S]methionine (1,100 Ci/ml) in the presence of drug vehicle (control) or 10 µM Eqn for 36 h. At the time points indicated, medium was removed from the cells. ApoA-I (A), apoA-II (B), and apoE (C) were immunoprecipitated from the medium. The results represent means ± SEM of four experiments. An unpaired t-test was used to evaluate changes between the Eqn-treated group and the control group at each time point. * P < 0.01.
|
|
Effect of Eqn on the rate of transcription of the human apoA-I gene
Nuclear runoff experiments were carried out to determine whether increased rates of transcription were responsible for the induction of apoA-I mRNA levels caused by Eqn treatment. The transcription rate of the apoA-I gene was measured by using isolated nuclei from HepG2/S cells cultured in the absence or presence of Eqn. The effect of Eqn on apoA-I transcription rates is illustrated in Fig 5. The rate of transcription of the human apoA-I gene increased approximately 2.5-fold between 16 and 24 h after stimulation.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5.
Time course of transcription rates of the apoA-I gene in HepG2/S cells cultured in the absence (solid circles) or presence (open circles) of Eqn. Transcription rates were determined by nuclear runoff assays using nuclei isolated from HepG2/S cells cultured in the absence or presence of Eqn (10 µM) as described in Materials and Methods. Nuclei (23 x 107) were isolated at 0, 2, 4, 10, 16, and 24 h. Hybridization of the newly synthesized [32P]RNA to plasmids containing the apoA-I insert was carried out in triplicate. Nonspecific hybridization to each filter was measured by performing transcription with labeled pGEM 3Z control vector. Filters were washed extensively and radioactivity bound was determined by liquid scintillation counting. Relative transcription rates were calculated as parts per million (ppm) per filter = [(cpm/filter) - background cpm] divided by the amount of [32P]RNA used in hybridization (input counts). These numbers were then normalized for hybridization efficiency as measured by binding of known amounts of 3H-labeled riboprobes added to the hybridization mixture. This was then corrected for the size of the specific gene: ppm/gene = [(ppm/filter)/% hybridization] x (gene size/cDNA insert size). Sizes of the apoA-I gene and apoA-I cDNA fragments were 2.0 and 0.6 kb, respectively. Results represent the means ± SE expressed in percentage of the 0-h time point of four independent experiments.
|
|
Characterization of the human apoA-I promoter region responsible for Eqn effect
The region involved in the transcriptional upregulation of the apoA-I gene by Eqn was further investigated by introducing various deletions and mutations in the base pair -249 to +7 region of the apoA-I promoter. These constructs were transiently transfected into HepG2 cells and the cells were then treated with vehicle or Eqn. The base pair -41 to +7 region of the human apoA-I gene, which contains minimal promoter activity for the human apoA-I gene, was used as the control vector. The luciferase activity of the pGL3-apoA-I(-41/+7)-luc construct in the cells treated with vehicle alone was arbitrarily set as 1 and the treatment with Eqn had no effect on this construct ( Fig 6A). In contrast, the basal promoter activity of the pGL3-apoA-I(-249/+7)-luc construct was about 70-fold higher than that of the pGL3-apoA-I(-41/+7)-luc construct. This activity was significantly induced 2.5-fold in the presence of Eqn (P < 0.01) (Fig 6B). These results indicated that the region responsible for induction of Eqn was located between base pairs -249 and -41 of the apoA-I promoter. Although the basal promoter activity of pGL3-apoA-I(-117/+7)-luc (5'-deletion construct) was nearly 3-fold higher than that of the minimal promoter construct apoA-I(-41/+7) (Fig 6C), Eqn had no effect on the promoter activity of this construct (Fig 6C). These data suggested that the region downstream of base pair -117 of the apoA-I promoter contributed little to the basal promoter activity of the apoA-I gene in HepG2 cells.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6.
Effect of Eqn on luciferase activity in various constructs of the apoA-I gene promoter in transfected HepG2 cells. Promoter constructs were prepared as described in Materials and Methods. Plasmid constructs contained the luciferase reporter gene under the control of the human apoA-I minimal basal promoter (-41 to +7 bp). Mutant constructs contained nucleotide substitutions that replace the apoA-I ARE. Freshly subcultured HepG2 cells on 24-well culture plates were transfected with each construct (0.5 µg/well) and with pRL-tk or pRL-null (10 ng/well), which was used to correct for variations in transfection efficiency. The dual-luciferase activities were assayed after cells were incubated with Eqn (10 µM) or drug vehicle (ethanol, <0.1%) for 24 h. Relative luciferase activity values represent the firefly luciferase activity versus the Renilla luciferase activity ratios relative to that of the pGL3-apoA-I(-41/+7) construct with drug vehicle incubation (arbitrarily defined as 1). The results represent means ± SEM of six independent experiments carried out in quadruplicate. One-way ANOVA was used followed by Dunnett's test or the Student-Newman-Keuls test as posttest for statistical analysis. * P < 0.01, unpaired t-test, versus control group for the same construct.
|
|
Furthermore, the elements between base pairs -249 and -117 of the apoA-I promoter appear to play a crucial role in the response to Eqn-mediated transcriptional regulation of the apoA-I gene. This region contains several important cis elements essential for the regulation of the apoA-I gene, including the apoA-I antioxidant response element (apoA-I-EpRE/ARE) located between base pairs -153 and -126 upstream from a transcription initiation site of the human apoA-I gene. The role of apoA-I-EpRE/ARE in the regulation of the apoA-I gene by Eqn was investigated by using the apoA-I-EpRE/ARE mutation construct [pGL3-apoA-I(-249/+7)mEpRE/mARE-luc]. The luciferase activity of this construct was 7-fold lower compared with the pGL3-apoA-I(-249/+7)-luc construct (Fig 6D). Treatment with Eqn had no effect on the luciferase activity of this mutant construct (Fig 6D). A construct with one copy of apoA-I-EpRE/ARE inserted upstream of apoA-I(-41/+7)-luc displayed a 2- to 3-fold increase in luciferase activity relative to the pGL3-apoA-I(-41/+7)-luc construct; this activity was further increased 2-fold on treatment of Eqn (Fig 6E). However, the mutated version of this construct [pGL3-apoA-I-mEpRE/mARE(-41/+7)-luc] showed no change in luciferase activity relative to that of the pGL3-apoA-I(-41/+7)-luc constructs, nor did it respond to the addition of Eqn (Fig 6F). Taken together, these data suggested that the integrity of the apoA-I-EpRE/ARE element not only plays an important role in the maintenance of basal promoter activity of the human apoA-I gene but also appears to be the key contributing factor responsible for Eqn-mediated transcriptional regulation of the human apoA-I gene.
Effect of estrogens and antiestrogens on the induction of apoA-I promoter activity by Eqn
To determine whether the Eqn-mediated induction of the apoA-I promoter can be further enhanced by estrogen (additive effect), or inhibited by antiestrogens, we tested the effect of 17ß-E2 and an antagonist, 4-hydroxytamoxifen (TAM), on apoA-I promoter activity in HepG2/S cells and HepG2 cells transfected with the apoA-I-EpRE/ARE-luc construct. Addition of these compounds together with Eqn did not further enhance or inhibit the Eqn-mediated induction of the apoA-I promoter, nor did either 17ß-E2 or TAM alone alter the apoA-I promoter activity ( Fig 7). These data indicated that the effect of Eqn on induction of the apoA-I promoter is specific and may not be mediated via the ER(s).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 7.
Effect of estrogens and antiestrogens on Eqn-mediated transcriptional regulation of the apoA-I promoter. A: HepG2/S cells were treated with ethanol (control), Eqn (10 µM), 4-hydroxytamoxifen (TAM, 100 nM), estradiol (E2, 10 nM), or a combination of Eqn with either tamoxifen or estradiol for 24 h. Firefly luciferase activity was measured and normalized with protein amounts. Values are expressed as a percentage of control. B: HepG2 cells were transfected with the apoA-I(EpRE/ARE)tk-luc construct. Sixteen hours after transfection, the medium was replaced with fresh medium containing ethanol (control), Eqn (10 µM), 4-hydroxytamoxifen (TAM, 100 nM), estradiol (E2, 10 nM), Eqn plus TAM, or E2. After 24 h of incubation, firefly luciferase and Renilla luciferase activities were determined. Results represent the means ± SEM of six independent experiments. One-way ANOVA was used followed by Dunnett's test or the Student-Newman-Keuls test as posttest for statistical analysis. * P < 0.01.
|
|
Regulation of apoA-I gene by Eqn is independent of ER
Electrophoretic mobility shift and supershift assays were performed to examine whether the Eqn-mediated transcriptional activation involved the binding of ER to the apoA-I-EpRE/ARE fragment. Nuclear proteins extracted from Eqn-treated HepG2 cells were incubated with radiolabeled apoA-I-EpRE/ARE fragment or vitellogenin estrogen response element (ERE) fragment. Using nuclear extract isolated from HepG2 cells, the DNA-binding activity interaction with radiolabeled apoA-I-EpRE/ARE was greater than that with radiolabeled ERE ( Fig 8). Although no supershift was observed with the addition of specific antibodies against ER and ERß, it appeared that addition of the antibodies resulted in decreased intensity of the retarded band (Fig 8, lane 1 vs. lanes 2 and 3). These results strongly suggested that ER and ERß were not present in the DNA-protein complex. However, the possibility that the antibodies could bind specifically to ER and block the formation of the complex, without generating a supershift band, could not be ruled out completely. As shown in Fig 8, nuclear proteins extracted from Eqn-treated MCF-7 cells bound efficiently to radiolabeled ERE to form a DNA-protein complex. This complex was supershifted by the specific antibodies against ER and ERß. In contrast, a weak complex resulted from the interaction of MCF-7 extracts with radiolabeled apoA-I-EpRE/ARE but did not supershift on addition of specific antibodies against ER and ERß (Fig 8).
To rule out the involvement of ER in the regulation of apoA-I gene by Eqn, several transient transfection and cotransfection experiments were performed ( Fig 9). A significant increase in transcriptional activity of apoA-I(-249/+7)-luc and apoA-I(EpRE/ARE)tk-luc constructs was observed in HepG2/S (stable) cells and HepG2 cells, respectively, on treatment with Eqn (Fig 9A). Cells transfected with ER expression vectors did not show an increase in luciferase activity of pGL3-apoA-I(-249/+7)-luc or apoA-I(EpRE/ARE)tk-luc constructs in the absence of Eqn (Fig 9A). Cotransfection with both ER and ERß expression vectors did not change the response to Eqn treatment in both HepG2/S cells and HepG2 cells transfected with the apoA-I(EpRE/ARE)tk-luc construct (Fig 9A). These results indicated that ER were not necessary in the regulation of the apoA-I gene by Eqn.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 9.
The involvement of ER in Eqn-mediated transcriptional regulation of the apoA-I promoter. Eqn-mediated transcriptional regulation of the apoA-I promoter is independent of ER. A: HepG2/S cells were transfected with 0.2 µg of ER expression vectors or empty vector (control). HepG2 cells were transfected with 1 µg of pGL3-apoA-I (EpRE/ARE)tk-luc construct and either 0.2 µg of ER expression vectors or the same amount of empty vector (control). PRL-tk vector was used as an internal control to normalize transfection efficiencies in HepG2 cells. Cells were incubated with 10 µM Eqn or ethanol (EtOH). Firefly luciferase activity was measured for transfection experiments with HepG2/S cells and HepG2 cells. Renilla luciferase activity was measured in HepG2 cells. For experiments using HepG2/S cells, the values were obtained after normalization of firefly luciferase activity with protein amounts. Normalization for HepG2 cell experiments was made from the ratio of firefly luciferase activity to Renilla luciferase activity. Values are reported as a percentage of control. B: MCF-7 cells were transfected with four reporter gene constructs: pGL3-apoA-I (-249/+7)-luc, pGL3-apoA-I(EpRE/ARE) tk-luc, pS2-luc, and pGL3-vit(ERE)tk-luc, at concentrations of 2 µg/well, together with pRL-tk or pRL-null vector as internal control to normalize transfection efficiencies. After transfection, cells were treated with either estrogens or control (ethanol, <0.1%) for 24 h. Values represent percent induction. Results represent the means ± SEM of six independent experiments. * P < 0.01 versus ethanol-treated control.
|
|
This was further evident by the transient transfection studies of ER-positive breast cancer cell line MCF-7. In contrast to the observations with HepG2/S and HepG2 cells, Eqn-mediated transcriptional activation was not observed with Eqn at 1 and 10 µM when the pGL3-apoA-I(-249+7)-luc construct or the pGL3-apoA-I(EpRE/ARE)tk-luc construct was transfected into MCF-7 cells (Fig 9B). These data provided further evidence that ER were not required for Eqn-mediated transcriptional regulation.
Similarly, 17ß-E2- and DES-mediated transcriptional activation was not observed with either of these constructs, possibly because of the absence of ERE in the base pair -249 to +7 region upstream from the transcriptional initial site of the apoA-I promoter. These data suggested that other auxiliary transcriptional factor(s) might be involved in the regulation of the human apoA-I gene. In contrast, Eqn at a concentration of 1 µM was able to increase luciferase activities of both pGL3-vit(ERE)tk-luc and pS2 constructs in MCF-7 cells. However, the enhancing effect of Eqn was not as strong as compared with 17ß-E2 or DES (Fig 9B).
 |
DISCUSSION |
|---|
Studies with transgenic mice and transient transfection analysis of the human apoA-I gene in cultured hepatoma cells have shown that liver-specific expression of the apoA-I gene is controlled by a strong hepatocyte-specific enhancer located in a 256-bp nucleotide region of a 5'-flanking sequence upstream from the apoA-I transcription start site (21) (23). Using functional DNA analysis of the human apoA-I gene promoter, the individual role of each estrogenic component of CEE that may play in the regulation of apoA-I gene expression was investigated.
The present data indicate that various estrogens present in CEE differentially regulate apoA-I promoter activity. Among the estrogens tested, the activities observed on the apoA-I promoter were Eqn > 17ß-Eqn > 17ß-Eq = Eq. CEE components such as E1, 17ß-E2, 17 -E2, 17 -Eq, 17 -Eqn, and 8-E1 did not significantly affect apoA-I promoter activity in this cell line. These observations are in keeping with previous observations that various estrogens have differential effects in terms of their antioxidant and neuroprotective properties (33) (40).
Other preparations (e.g., piperazine estrone sulfate, micronized estradiol) containing only one or two estrogen components may not be as active in the regulation of apoA-I promoter activity as CEE. Previous studies (34) have also demonstrated that ring B-unsaturated estrogens, such as Eq, equilin sulfate, and 8-E1, are activated in vivo in postmenopausal women to a greater extent than the estrogens E1 and 17ß-E2. In the present study, the extent of metabolism under the culture conditions used was minimal (X. Zhang, J-J. Jiao, B. R. Bhavnani, and S-P. Tam, unpublished data); thus, the effects of various estrogens observed were most likely due to the estrogen tested rather than its metabolites. Because these in vitro experiments with HepG2 cells were carried out in the presence of 10% CTFBS, the concentrations of estrogens needed to stimulate apoA-I transcription are high (micromolar). This is most likely due to lower concentrations of bioavailable or bioactive estrogen (estrogen unbound to serum proteins) that results from the binding of the estrogens to serum proteins such as albumin.
The 2.5- to 3-fold increase in apoA-I promoter activity caused by Eqn treatment was accompanied by a comparable increase in apoA-I mRNA. The half-life of apoA-I mRNA was not significantly affected by Eqn, suggesting that the induction of apoA-I mRNA level in response to Eqn is mediated at the transcriptional level. This observation was further confirmed by nuclear runoff assays, which indicated that the transcription rate of the apoA-I gene was also increased by 2.5-fold in Eqn-treated cells (Fig 5). However, no significant correlation between apoA-I mRNA level and apoA-I protein secretion was observed. These data strongly suggest that apoA-I protein secretion is not only dependent on the amount of apoA-I mRNA available; both translational and/or posttranslational regulation may be involved. Previous studies (41) (42) of rodents have similarly shown that pharmacological doses of 17 -ethinyl estradiol and 17ß-E2 result in higher level of apoA-I mRNA and gene transcription, and an increase in apoA-I protein synthesis. Although Eqn also increased the level of secreted apoE protein, it did not affect apoA-II protein levels, indicating that the action of Eqn is selective and affects only some apolipoproteins. Previous studies have reported that 17ß-E2 increased apoE by regulation of the mRNA pool of apoE (43). It remains to be determined whether Eqn increases apoE by this mechanism.
Trans-activation of the human apoA-I promoter in response to Eqn was also observed in transient gene transfer experiments in cell cultures. The present study mapped the elements required to mediate the Eqn response by using several apoA-I promoter deletion and mutation luciferase reporter constructs. The element contains a core EpRE/ARE that had been previously identified in studies of the effect of gramoxone and dimethyl sulfoxide on apoA-I gene expression (24) (30). This EpRE/ARE was first identified in the regulation of the rat glutathione S-transferase Ya subunit gene, which acts in response to metabolites of pro-oxidant/antioxidant compounds (44). Although electrophilic metabolites, that is, electrophile/redox-active quinoids, can be generated in vitro from Eqn (28) (29), they were not formed under the culture conditions studied (data not shown). At moderately high concentrations, certain forms of reactive oxygen species may act as intracellular messengers in signal transduction that lead to the regulation of gene transcription through the EpRE/ARE (45). The data from the present study indicate that Eqn-mediated transcriptional regulation of human apoA-I gene does act through the apoA-I EpRE/ARE.
Estrogens have diverse physiological effects that are mediated via ER (ER and ERß) to a major extent. These receptors function as hormone-activated transcription factors and modulators of gene expression in target cells (27) (43) (46). Earlier studies have demonstrated that exposure of HepG2 cells to 17ß-E2 increases the levels of human apoA-I protein in a dose-dependent fashion (35) (47). The increase in protein levels correlated with the rise in apoA-I mRNA level (47). Studies using a cell line stably expressing ER and transient transfection methods indicated that the action of 17ß-E2 on the apoA-I gene may occur through a transcription factor-sharing pathway involving ER and other cofactors (25). A previous comparative study on the measurement of the relative binding affinities of the estrogenic components of CEE (in their unconjugated form) for ER in human endometrium and rat uterus demonstrated that all of these estrogens bind with high affinity to the ER, although Eqn, in comparison with others, had much lower receptor affinity (48). Thus, it was reasonable to speculate that the effect of Eqn on apoA-I promoter may function through an ER pathway. However, the present data raise questions regarding this hypothesis. First, as in previous studies, specific antibodies against both ER and ERß were unable to detect the presence of ER in HepG2/S cell by gel mobility supershift assays. Second, despite the lack of functional ER, Eqn still induced apoA-I gene promoter activity nearly 3-fold, which led to increased levels of apoA-I mRNA and apoA-I protein. Third, cotransfection with both ER into HepG2/S cells was unable to influence the action of Eqn on apoA-I gene promoter activity. Fourth, 17ß-E2 and E1, and antagonists such as TAM, could not block the transcriptional induction of apoA-I promoter by Eqn. Finally, because the apoA-I EpRE/ARE has some resemblance to the consensus AP-1 response element, we also determined whether Fos-Jun binding to the apoA-I EpRE/ARE motif occurs. By performing electrophoretic mobility supershift assays, no DNA-protein complex was supershifted by the specific antibodies against c-Fos and c-Jun (X. Zhang, J-J. Jiao, B. R. Bhavnani, and S-P. Tam, unpublished results). This suggests that the alternative pathway of ER action via AP-1 sites is not responsible for Eqn action (46) (49). Taken together, these data indicate that ER are not directly involved in Eqn-mediated regulation of the human apoA-I gene, and that Eqn action is perhaps mediated via an ER-independent mechanism.
The observed activation of the apoA-I gene by Eqn via the apoA-I-EpRE/ARE differs from the data reported by Montano and Katzenellenbogen (50), which identified a unique estrogen response pathway in MCF-7 cells involved in the induction of the NAD(P)H:quinone oxidoreductase gene by antiestrogens such as trans-hydroxytamoxifen (TOT). This pathway was ER dependent and was mediated through an EpRE/ARE. The addition of 17ß-E2 had no effect on this pathway, but did antagonize the action of TOT, presumably through competition with ER. In the present transient transfection experiments using MCF-7 cells, 17ß-E2 also had no effect on the apoA-I-EpRE/ARE construct. However, in contrast to the HepG2 cell experiments, Eqn did not increase the luciferase activity of the construct, although the ERE construct could be induced by Eqn treatment. Thus the Eqn-mediated induction of apoA-I-EpRE/ARE was ER independent and required participation of hepatic factor(s) that have not yet been defined.
Both E1 and 17ß-E2 had no effect on the activity of the apoA-I gene promoter in the present experiments. The failure of 17ß-E2-mediated transcriptional regulation of the apoA-I gene promoter may be due to the unsuitable combination of ER and receptor-interacting protein 140 (RIP140), as demonstrated in one study (25). These investigators suggested that the appropriate ratio of ER and RIP140 plays a crucial role in 17ß-E2-mediated transcriptional regulation of the human apoA-I gene. Whether Eqn-mediated transcriptional regulation of the apoA-I gene involves RIP140 in the absence of ER remains to be determined. Similarly, other transcriptional factors such as SP-1, hepatocyte nuclear factor 4 (HNF-4), and HNF-3ß may also be involved in Eqn-mediated transcriptional regulation of human apoA-I promoter activity. This is currently being investigated. Furthermore, additional experiments will be required to further understand whether other cis-acting elements and distal enhancers in the apoA-I/apoC-III/apoA-IV gene cluster (51) (52) (53) are involved in the regulation of human apoA-I gene expression in response to Eqn treatment.
In conclusion, the present study identified Eqn as a strong modulator of transcriptional regulation of the human apoA-I gene. The activation of Eqn is mediated through an apoA-I-EpRE/ARE pathway that does not require the participation of ER but may need the involvement of liver-specific factor(s). This action of Eqn and other ring B-unsaturated estrogens is a novel finding that may explain the mechanism by which CEE administration reduces the risk of CHD in postmenopausal women.
 |
ACKNOWLEDGMENTS |
|---|
The authors thank Francine Bhavnani for her excellent secretarial skills. This work has supported by the Medical Research Council of Canada grants MT-11329 (B.R.B.) and MT-11223 (S-P.T.)
Manuscript received January 30, 2001; and in revised form June 18, 2001
Abbreviations:
17 -E2, 17 -estradiol; 17ß-E2, 17ß-estradiol; 8-E1, -8-estrone; apoA-I, apolipoprotein A-I; CEE, conjugated equine estrogen; CHD, coronary heart disease; CTFBS, charcoal-treated FBS; DES, diethylstilbestrol; EpRE/ARE, electrophile/antioxidant response element; E1, estrone; Eq, equilin; Eqn, equilenin; ERE, estrogen response element; HEGO, human estrogen receptor expression vector (wild type); HEO, human estrogen receptor expression vector (variant); HepG2, human hepatoma cell line G2; HepG2/S, HepG2 stable cell line; MCF-7, human breast adenocarcinoma cell line; TAM, 4-hydroxytamoxifen; TOT, trans-hydroxytamoxifen
 |
REFERENCES |
|---|
- Eaker, E. D., Packard, B., Thom, T. J. 1989. Epidemiology and risk factors for coronary heart disease in women. Cardiovasc. Clin. 19:129-145[Medline].
- Lerner, D. J., Kannel, W. B. 1986. Patterns of coronary heart disease morbidity and mortality in the sexes: a 26-year follow-up of the Framingham population. Am. Heart J. 112:383-390.
- Ross, R. 1986. The pathogenesis of atherosclerosis an update. N. Engl. J. Med. 314:488-500[Medline].
- Brown, M. S., Goldstein, J. L. 1992. Koch's postulates for cholesterol. Cell. 71:187-188[Medline].
- Brown, G., Albers, J. J., Fisher, L. D., Schaefer, S. M., Lin, J. T., Kaplan, C., Zhao, X. Q., Brisson, B. D., Fitzpatrick, V. F., Dodge, H. T. 1990. Regression of coronary artery disease as a result of intensive lipid-lowering therapy in men with high levels of apolipoprotein B. N. Engl. J. Med. 323:1289-1298[Abstract].
- Grodstein, F., Stampfer, M. 1995. The epidemiology of coronary heart disease and estrogen replacement in postmenopausal women. Prog. Cardiovasc. Dis. 38:199-210[Medline].
- Lindsay, R., Bush, T. L., Grady, D., Speroff, L., Lobo, R. A. 1996. Therapeutic controversy: estrogen replacement in menopause. J. Clin. Endocrinol. Metab. 81:3829-3838[Free Full Text].
- Effects of estrogen or estrogen/progestin regimens on heart disease risk factors in postmenopausal women. The Postmenopausal Estrogen/Progestin Interventions (PEPI) Trial. (1995) JAMA. 273:199-208[Abstract/Free Full Text].
- Espeland, M. A., Marcovina, S. M., Miller, V., Wood, P. D., Wasilauskas, C., Sherwin, R., Schrott, H., Bush, T. L. 1998. Effect of postmenopausal hormone therapy on lipoprotein(a) concentration. PEPI Investigators. Postmenopausal Estrogen/Progestin Interventions. Circulation. 97:979-986[Abstract/Free Full Text].
- Hulley, S., Grady, D., Bush, T., Furberg, C., Herrington, D., Riggs, B., Vittinghoff, E. 1998. Randomized trial of estrogen plus progestin for secondary prevention of coronary heart disease in postmenopausal women. Heart and Estrogen/Progestin Replacement Study (HERS) Research Group. JAMA. 280:605-613[Abstract/Free Full Text].
- Barrett-Connor, E., Bush, T. L. 1991. Estrogen and coronary heart disease in women. JAMA. 265:1861-1867[Abstract/Free Full Text].
- Tikkanen, M. J. 1993. Mechanisms of cardiovascular protection by postmenopausal hormone replacement therapy. Cardiovasc. Risk Factors. 3:138-143.
- Walsh, B. W., Schiff, I., Rosner, B., Greenberg, L., Ravnikar, V., Sacks, F. M. 1991. Effects of postmenopausal estrogen replacement on the concentrations and metabolism of plasma lipoproteins. N. Engl. J. Med. 325:1196-1204[Abstract].
- Pickar, J. H., Thorneycroft, I., Whitehead, M. 1998. Effects of hormone replacement therapy on the endometrium and lipid parameters: a review of randomized clinical trials, 1985 to 1995. Am. J. Obstet. Gynecol. 178:1087-1099[Medline].
- Miller, N. E., La Ville, A., Crook, D. 1985. Direct evidence that reverse cholesterol transport is mediated by high-density lipoprotein in rabbit. Nature. 314:109-111[Medline].
- Rosenson, R. S. 1996. Beyond low-density lipoprotein cholesterol. A perspective on low high-density lipoprotein disorders and Lp(a) lipoprotein excess. Arch. Intern. Med. 156:1278-1284[Abstract/Free Full Text].
- Parthasarathy, S., Barnett, J., Fong, L. G. 1990. High-density lipoprotein inhibits the oxidative modification of low-density lipoprotein. Biochim. Biophys. Acta. 1044:275-283[Medline].
- Watson, A. D., Berliner, J. A., Hama, S. Y., La Du, B. N., Faul, K. F., Fogelman, A. M., Navab, M. 1995. Protective effect of high density lipoprotein associated paraoxonase. Inhibition of the biological activity of minimally oxidized low density lipoprotein. J. Clin. Invest. 96:2882-2891.
- Steinberg, D., Parthasarathy, S., Carew, T. E., Khoo, J. C., Witztum, J. L. 1989. Beyond cholesterol. Modifications of low-density lipoprotein that increase its atherogenicity. N. Engl. J. Med. 320:915-924[Medline].
- Rubin, E. M., Krauss, R. M., Spangler, E. A., Verstuyft, J. G., Clift, S. M. 1991. Inhibition of early atherogenesis in transgenic mice by human apolipoprotein AI. Nature. 353:265-267[Medline].
- Higuchi, K., Law, S. W., Hoeg, J. M., U. K. Schumacher, N. Meglin, and H. B. Brewer, Jr,. 1988. Tissue-specific expression of apolipoprotein A-I (apoA-I) is regulated by the 5'-flanking region of the human apoA-I gene. J. Biol. Chem. 263:18530-18536[Abstract/Free Full Text].
- Ladias, J. A., Karathanasis, S. K. 1991. Regulation of the apolipoprotein AI gene by ARP-1, a novel member of the steroid receptor superfamily. Science. 251:561-565[Abstract/Free Full Text].
- Sastry, K. N., Seedorf, V., Karathanasis, S. K. 1988. Different cis-acting DNA elements control expression of the human apolipoprotein AI gene in different cell types. Mol. Cell Biol. 8:605-614[Abstract/Free Full Text].
- Cuthbert, C., Wang, Z., Zhang, X., Tam, S. P. 1997. Regulation of human apolipoprotein A-I gene expression by gramoxone. J. Biol. Chem. 272:14954-14960[Abstract/Free Full Text].
- Harnish, D. C., Evans, M. J., Scicchitano, M. S., Bhat, R. A., Karathanasis, S. K. 1998. Estrogen regulation of the apolipoprotein AI gene promoter through transcription cofactor sharing. J. Biol. Chem. 273:9270-9278[Abstract/Free Full Text].
- Jin, F. Y., Kamanna, V. S., Kashyap, M. L. 1998. Estradiol stimulates apolipoprotein A-I- but not A-II-containing particle synthesis and secretion by stimulating mRNA transcription rate in Hep G2 cells. Arterioscler. Thromb. Vasc. Biol. 18:999-1066[Abstract/Free Full Text].
- Montano, M. M., Jaiswal, A. K., Katzenellenbogen, B. S. 1998. Transcriptional regulation of the human quinone reductase gene by antiestrogen-liganded estrogen receptor-alpha and estrogen receptor-beta. J. Biol. Chem. 273:25443-25449[Abstract/Free Full Text].
- Chen, Y., Liu, X., Pisha, E., Constantinou, A. I., Hua, Y., Shen, L., van Breemen, R. B., Elquindi, E. C., Blond, S. Y., Zhang, F., Bolton, J. L. 2000. A metabolite of equine estrogens, 4-hydroxyequilenin, induces DNA damage and apoptosis in breast cancer cell lines. Chem. Res. Toxicol. 13:342-350[Medline].
- Sarabia, S. F., Zhu, B. T., Kurosawa, T., Tohma, M., Liehr, J. G. 1997. Mechanism of cytochrome P450-catalyzed aromatic hydroxylation of estrogens. Chem. Res. Toxicol. 10:767-771[Medline].
- Tam, S. P., Zhang, X., Cuthbert, C., Wang, Z., Ellis, T. 1997. Effects of dimethyl sulfoxide on apolipoprotein A-I in the human hepatoma cell line, HepG2. J. Lipid Res. 38:2090-2102[Abstract].
- Subbiah, M. T., Kessel, B., Agrawal, M., Rajan, R., Abplanalp, W., Rymaszewski, Z. 1993. Antioxidant potential of specific estrogens on lipid peroxidation. J. Clin. Endocrinol. Metab. 77:1095-1097[Abstract].
- Wilcox, J. G., Hwang, J., Hodis, H. N., Sevanian, A., Stanczyk, F. Z., Lobo, R. A. 1997. Cardioprotective effects of individual conjugated equine estrogens through their possible modulation of insulin resistance and oxidation of low-density lipoprotein. Fertil. Steril. 67:57-62[Medline].
- Bhavnani, B. R., Cecutti, A., Gerulath, A., Woolever, C. A. 1997. Are cardiovascular benefits associated with conjugated equine estrogen therapy and red wine consumption a result of the antioxidant properties of their components? J. Soc. Gynecol. Invest. 4(Suppl.):106A. (Abstract).
- Bhavnani, B. R. 1998. Pharmacokinetics and pharmacodynamics of conjugated equine estrogens: chemistry and metabolism. Proc. Soc. Exp. Biol. Med. 217:6-16[Medline].
- Tam, S. P., Archer, T. K., Deeley, R. G. 1985. Effects of estrogen on apolipoprotein secretion by the human hepatocarcinoma cell line, HepG2. J. Biol. Chem. 260:1670-1675[Abstract/Free Full Text].
- Mohan, W. S., Chen, Z. Q., Zhang, X., Khalili, K., Honjo, T., Deeley, R. G., Tam, S. P. 1998. Human S mu binding protein-2 binds to the drug response element and transactivates the human apoA-I promoter: role of gemfibrozil. J. Lipid Res. 39:255-267[Abstract/Free Full Text].
- Zhang, X., Chen, Z. Q., Wang, Z., Mohan, W., Tam, S. P. 1996. Protein-DNA interactions at a drug-responsive element of the human apolipoprotein A-I gene. J. Biol. Chem. 271:152-160.
- Bartalena, L., Farsetti, A., Flink, I. L., Robbins, J. 1992. Effect of interleukin-6 on the expression of thyroid hormone-binding protein genes in cultured human hepatoblastoma (HepG2) cells. Mol. Endocrinol. 6:935-942[Abstract/Free Full Text].
- Tam, S-P., Deeley, R. G. 1994. Regulation of apolipoprotein A-I gene expression by phenobarbital in the hepatocarcinoma cell line, Hep3B. Atherosclerosis. 105:235-243[Medline].
- Berco, M., Bhavnani, B. R. 2000. Neuroprotective effects of equine estrogens against oxodozed LDL-induced neuronal cell death. J. Soc. Gynecol. Invest. 7(Suppl.):186. (Abstract).
- Seishima, M., Bisgaier, C. L., Davies, S. L., Glickman, R. M. 1999. Regulation of hepatic apolipoprotein synthesis in the 17 alpha-ethinyl estradiol-treated rat. J. Lipid Res. 32:941-951[Abstract].
- Tang, J. J., Srivastava, R. A., Krul, E. S., Baumann, D., Pfleger, B. A., Kitchens, R. T., Schonfeld, G. 1991. In vivo regulation of apolipoprotein A-I gene expression by estradiol and testosterone occurs by different mechanisms in inbred strains of mice. J. Lipid Res. 32:1571-1585[Abstract].
- Srivastava, R. A., Srivastava, N., Averna, M., Lin, R. C., Korach, K. S., Lubahn, D. B., Schonfeld, G. 1997. Estrogen up-regulates apolipoprotein E (apoE) gene expression by increasing apoE mRNA in the translating pool via the estrogen receptor alpha-mediated pathway. J. Biol. Chem. 272:33360-33366[Abstract/Free Full Text].
- Rushmore, T. H., Morton, M. R., Pickett, C. B. 1991. The antioxidant responsive element. Activation by oxidative stress and identification of the DNA consensus sequence required for functional activity. J. Biol. Chem. 266:11632-11639[Abstract/Free Full Text].
- Sen, C. K., Packer, L. 1996. Antioxidant and redox regulation of gene transcription. FASEB J. 10:709-720[Abstract].
- Paech, K., Webb, P., Kuiper, G. G., Nilsson, S., Gustafsson, J., Kushner, P. J., Scanlan, T. S. 1997. Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science. 277:1508-1510[Abstract/Free Full Text].
- Tam, S. P., Archer, T. K., Deeley, R. G. 1986. Biphasic effects of estrogen on apolipoprotein synthesis in human hepatoma cells: mechanism of antagonism by testosterone. Proc. Natl. Acad. Sci. USA. 83:3111-3115[Abstract/Free Full Text].
- Bhavnani, B. R., Woolever, C. A. 1991. Interaction of ring B unsaturated estrogens with estrogen receptors of human endometrium and rat uterus. Steroids. 56:201-210[Medline].
- Umayahara, Y., Kawamori, R., Watada, H., Imano, E., Iwama, N., Morishima, T., Yamasaki, Y., Kajimoto, Y., Kamada, T. 1994. Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1 enhancer. J. Biol. Chem. 269:16433-16442[Abstract/Free Full Text].
- Montano, M. M., Katzenellenbogen, B. S. 1997. The quinone reductase gene: a unique estrogen receptor-regulated gene that is activated by antiestrogens. Proc. Natl. Acad. Sci. USA. 94:2581-2586[Abstract/Free Full Text].
- Bisaha, J. G., Simon, T. C., Gordon, J. I., Breslow, J. L. 1995. Characterization of an enhancer element in the human apolipoprotein C-III gene that regulates human apolipoprotein A-I gene expression in the intestinal epithelium. J. Biol. Chem. 34:19979-19988.
- Vergnes, L., Taniguchi, T., Omori, K., Zakin, M. M., Ochoa, A. 1997. The apolipoprotein A-I/C-III/A-IV gene cluster: apoC-III and apoA-IV is regulated by two common enhancers. Biochim. Biophys. Acta. 1348:299-310[Medline].
- Jones, D. R., Leffak, M. 1999. A bifunctional regulatory element of the human apoA-I gene responsive to a distal enhancer. DNA Cell Biol. 18:107-119[Medline].

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. R. Bhavnani, S.-P. Tam, and X. Lu
Structure Activity Relationships and Differential Interactions and Functional Activity of Various Equine Estrogens Mediated via Estrogen Receptors (ERs) ER{alpha} and ER{beta}
Endocrinology,
October 1, 2008;
149(10):
4857 - 4870.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Yang, C.-Q. Lai, L. Parnell, L. A. Cupples, X. Adiconis, Y. Zhu, P. W. F. Wilson, D. E. Housman, A. M. Shearman, R. B. D'Agostino, et al.
Genome-wide linkage analyses and candidate gene fine mapping for HDL3 cholesterol: the Framingham Study
J. Lipid Res.,
July 1, 2005;
46(7):
1416 - 1425.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lamon-Fava and D. Micherone
Regulation of apoA-I gene expression: mechanism of action of estrogen and genistein
J. Lipid Res.,
January 1, 2004;
45(1):
106 - 112.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
Advertisement
Advertisement
|