Journal of Lipid Research, Vol. 42, 528-535, April 2001
Copyright © 2001 by Lipid Research, Inc.
Decreased stability of the M54 isoform of paraoxonase as a contributory factor to variations in human serum paraoxonase concentrations
Ilia Levieva,
Sara Deakina, and
Richard W. Jamesa
a Clinical Diabetes Unit, Division of Endocrinology and Diabetology, University Hospital, 1211 Geneva 14, Switzerland
Correspondence to:
Richard W. James, To whom correspondence should be addressed., Richard.James{at}hcuge.ch (E-mail)
 |
ABSTRACT |
|---|
There are considerable variations in serum concentrations of the high density lipoprotein (HDL)-associated enzyme, paraoxonase (PON), which is an important determinant of the antioxidant capacity of HDL. The present study examined the hypothesis that differences in the stability of isoforms arising from the coding region L54M polymorphism could contribute to such variations. A model system was developed using transfected Chinese hamster ovary cells to secrete recombinant PON corresponding to human L or M isoforms. The recombinant peptides exhibited the molecular properties of human serum PON. They formed complexes with lipoproteins in culture medium, notably binding to apolipoprotein A-I-containing particles. The enzymatic properties of the recombinant isoforms were comparable to those of human serum PON. The recombinant M isoform lost activity more rapidly and to a greater extent than the recombinant L isoform [26.0 ± 3.0% vs. 14.0 ± 1.0% (phenylacetate substrate) and 36.1 ± 2.0% vs. 19.3 ± 2.0% (paraoxon substrate) over 96 h (P < 0.01)] in medium containing fetal calf serum or PON-free human serum. Addition of a protease inhibitor resulted in retention of activity by both isoforms. Parallel results were obtained in incubation studies of human serum from donors homozygous LL or MM for the L54M polymorphism. Enzyme activity was lost more rapidly and to a greater extent from MM than LL sera (P < 0.01). A parallel loss of PON peptide mass was also observed, with a significantly greater loss from MM homozygotes (P < 0.001). It corresponded to the appearance of a smaller molecular mass band on SDS-PAGE analysis. Direct analysis of the proteolytic effect using HDL isolated from homozygotes and incubated with purified kallikrein confirmed the greater loss of activity from MM homozygotes and the protective effect of proteolysis inhibitor.
The results provide evidence for lesser stability of the M54 isoform of PON, apparently involving greater susceptibility to proteolysis. It provides one mechanism to explain variations in serum levels of PON and has implications for the antioxidant capacity of HDL. Leviev, I., S. Deakin, and R. W. James. Decreased stability of the M54 isoform of paraoxonase as a contributory factor to variations in human serum paraoxonase concentrations. J. Lipid Res. 2001. 42: 528;535.
Supplementary key words:
oxidative stress, HDL, polymorphism, coronary disease, recombinant protein
 |
INTRODUCTION |
|---|
Paraoxonase (PON) is a serum enzyme entirely complexed to high density lipoprotein (HDL) (1). Clinical interest in the enzyme derived initially from its ability to neutralize highly toxic exogenous derivatives, notably pesticides (2), thus highlighting its potential importance as a protective agent against environmental poisoning. Such derivatives also include nerve gases (2) (3), further underlining the potential protective benefits of serum PON activity. Recent clinical interest in the enzyme has arisen from the hypothesis that PON protects low density lipoproteins (LDL) from lipid peroxidation (4) (5). Peroxidation can induce substantial changes to the behavior of LDL, modifying its metabolism and, equally important, its ability to influence gene expression (6) (7). The latter is suggested to be the basis for the inflammatory effect of oxidized LDL (6) (8) and, more generally, the strong association between LDL and risk of vascular disease. The activity of PON thus confers an anti-inflammatory/antioxidant function on HDL (5) (9). Consequently, factors that diminish the PON content of HDL will affect this protective role. Animal models provide support for this contention, in which lower serum levels of PON are associated with greater susceptibility of LDL to oxidation and increased risk of atheroma (10) (11). Thus, factors that influence serum PON are of particular clinical relevance.
There are considerable interindividual variations in serum concentrations of PON (12) (13). In our attempts to identify factors involved, we have focused both on its serum transport vehicle, HDL (1) (12) (14), and genetic influences. Our earlier studies demonstrated that a coding region polymorphism affecting amino acid 54 (L54M) was associated with highly significant variations in serum concentrations of PON. A second common polymorphism at amino acid position 191 (Q191R) was not associated with concentration (13). Subsequent studies showed differences in the levels of expression of L- and M-type mRNA by human liver biopsies, consistent with observed differences in serum PON concentrations between the isoforms (15). This clearly indicated a genetic basis to variations in serum PON levels. Most recently, we identified polymorphisms in the promoter region of the PON1 gene, which appear to have a predominant effect on serum concentrations of the enzyme (16). There is also strong linkage dis-equilibrium between the promoter and coding region L54M polymorphisms. However, our analyses indicated that the promoter polymorphisms do not entirely account for the association between the L54M polymorphism and variations in serum PON concentrations. The present study was undertaken to attempt to explain this observation. We examined the hypothesis that differences in the stability of L- and M-type PON isoforms could contribute to variations in serum concentrations and activities of the enzyme.
 |
METHODS |
|---|
Analysis of PON gene polymorphisms, activities, and concentrations
Serum samples analyzed in the present study were obtained from subjects recruited at the university hospital and medical research center in Geneva. Participants gave informed written consent and the study was conducted according to the ethical requirements of the medical faculty. DNA was extracted from blood lymphocytes and the promoter and coding region polymorphisms genotyped as described (13) (16) (17). PON was quantified by a competitive enzyme-linked immunosorbent assay (ELISA), as described previously in detail (12), and enzyme activities were determined with paraoxon (PON activity) and phenylacetate (arylesterase activity) (12).
Single- and two-dimensional polyacrylamide gel electrophoresis (PAGE) of culture medium conditioned by Chinese hamster ovary (CHO) cells secreting human PON were performed as described previously (1) (18). Profiles were electrotransferred to nitrocellulose sheets and processed by immunoblotting with anti-PON antibody (1).
Expression of PON isoforms
PON cDNA was obtained by reverse transcription of RNA from human liver (heterozygous LM for the 54 polymorphism; homozygous AA for the 191 polymorphism), using the oligonucleotide primer (antisense) CCTCGGAATATGGCAAGCGG complementary to nucleotides from 1116 to 1135 of human PON mRNA. The cDNA was amplified by polymerase chain reaction (PCR), using oligonucleotide primers CAAAAGCTTATGGCGAAGCTGATTGCGC TCACCC (sense) complementary to positions from 1 to 25 of PON1 mRNA and ATGGCATGGGTGCAAATCGG (antisense) complementary to positions from 1073 to 1092. The design of primers was based on the human PON1 cDNA sequence obtained by Hassett et al. (19); numbers are from A of the initiation codon. Thermostable Pfu polymerase (Stratagene) was used for ampli
cation. PCR products were cloned into a plasmid containing an expression cassette with the SV-40 promoter. The entire cDNA was subsequently sequenced to ensure i) the presence of the desired nucleotides at the positions coding for amino acids 191 and 54, and ii) the absence of other alterations in cDNA.
CHO cells were grown in Iscove's modified Eagle's medium (Gibco) supplemented with 10% fetal calf serum (Gibco). (The PON activity of fetal calf serum was negligible.) Cells were transfected with 5 µg of plasmid DNA containing either the L- or M-type alleles and 15 µl of Superfect reagent (Qiagen). Conditioned medium was removed 24 h after transfection for measurement of activities and used nonconcentrated in studies.
Isolation of lipoproteins
Lipoproteins were isolated from fasting human serum samples by sequential gradient ultracentrifugation (20) (LDL, d = 1.019;1.063 g/ml; HDL, d = 1.063;1.21 g/ml). Total lipoprotein was isolated by ultracentrifugation at d = 1.23 g/ml.
Immunoaffinity depletion of human apolipoprotein (apo) A-I from culture medium was performed as described previously (18). Briefly, culture medium containing 10% PON-free human serum [PON was removed by immunoaffinity chromatography (1)] was conditioned by PON-transfected CHO cells. An aliquot was passed onto an anti-apoA-I column, incubated 1 h, and washed to remove unbound protein. The nonbound eluant was collected and concentrated.
Electrophoresis
Human serum and culture medium containing isolated human HDL were subjected to agarose gel electrophoresis using the Sebia hydragel system (Sebia; Issy Les-Moulineaux, France). They were also analyzed by single-dimensional SDS-PAGE under nonreducing conditions and immunoprobed with anti-apoA-I antibodies after electrotransfer to nitrocellulose sheets (1).
PON stability
To test PON stability, culture medium was conditioned by transiently transfected cells, filtered under sterile conditions, then incubated at 37°C. Studies were performed with conditioned media containing the same PON enzyme activity levels per milliliter of medium for the L and M isoforms. Aliquots were removed at intervals under sterile conditions to test PON. In some studies, fetal calf serum of the culture medium was replaced with 10% human serum from which endogenous PON had been removed as described above. In other studies, the protease inhibitor aprotinin was added to the conditioned medium (final concentration 28 µg/ml) prior to incubation. In studies where the protease kallikrein (Sigma) was used, an aliquot was removed prior to addition of kallikrein to establish the baseline PON activity/concentration. Protease activity in aliquots removed after timed intervals was inhibited with aprotinin (10-fold excess). In control incubations, aprotinin was added to the HDL samples prior to adding kallikrein.
 |
RESULTS |
|---|
Table 1 shows serum concentrations and activities of PON in a population that was selected to be homozygous for polymorphisms of the promoter region of the PON1 gene (haplotype CGT-CGT, reflecting nucleotides at the ;907, ;824, ;107 polymorphic sites) (16). There were significant differences in concentrations between subgroups defined by genotypes of the L54M polymorphism. Carriers homozygous for the L allele had significantly higher concentrations of PON than MM homozygotes; heterozygotes had intermediate values. This was paralleled by similar differences in enzyme activity using phenylacetate or paraoxon as substrates. To eliminate the possible confounding effects of the Q191R polymorphism on paraoxon hydrolytic activity, the latter was also analyzed in subjects homozygous QQ for the 191 site. As shown in Table 1, differences in activity between L54M genotypes remained highly significant. Specific activity did not differ between the genotypes (Table 1), indicating that the effect concerns protein mass rather than the enzymatic site of PON.
In a first series of studies, we analyzed L and M isoforms that had been produced by transiently transfected CHO cells. Examples of immunoblots of single- and two-dimensional gel profiles of PON (L at position 54 and Q at the 191 polymorphic site) secreted by transfected cells are shown in Fig 1. For comparison, profiles of human serum PON are also given. The two profiles were very similar. In single-dimensional SDS-PAGE gels, the recombinant protein (Fig 1A, lane 2) showed the presence of major and minor bands corresponding to human serum PON (Fig 1A, lane 1), as we previously reported (1). The molecular size of recombinant PON (43;46 kDa) corresponds to that of human serum PON. The two-dimensional profiles (Fig 1A, images 3, 4) were again quite comparable and typical of glycosylated proteins. Analyses of the relative enzyme activities with paraoxon and phenylacetate [activity (U/ml) with paraoxon in 1 M NaCl]/[activity (U/ml) with phenylacetate] were 2.94 ± 0.11 and 2.98 ± 0.07 (n = 3 for both) in two different preparations of conditioned medium. This mirrors the relative ratios of activities measured in human serum samples (2.85 ± 1.19; n = 462) and to literature values for PON isoforms homozygous for the A allele at position 191 (21). Fast protein liquid chromatographic (FPLC) analysis (1) revealed that PON in conditioned medium had the molecular size of human HDL. As shown in Fig 2, PON in conditioned culture medium co-eluted with serum PON, and both were in the higher molecular mass range of the HDL peak. No PON protein could be detected by Western blot in tubes not containing enzyme activity. Culture medium was also prepared containing human serum from which the PON-containing fraction had been removed by specific immunoaffinity chromatography. This procedure (1) removes less than 10% of HDL apoA-I. The preparation was used to confirm the association of PON with HDL after incubation with PON-secreting cells by two means. Ultracentrifugation of the culture medium showed the majority of recombinant PON activity (approximately 85%) to be associated with the d < 1.23 g/ml fraction for both isoforms. This compares with 91% of human serum PON associated with the d < 1.23 g/ml fraction ( Table 2). Second, when the culture medium was passed through an anti-human apoA-I affinity column, the majority of PON activity was removed for both isoforms (Table 2). In a previous study, we observed that human apoA-I immunoabsorption removed 89% of serum PON (1). There were no significant differences between the L and M isoforms with respect to the percentages associated with the lipoprotein fractions defined by ultracentrifugation or immunoaffiity absorption.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1.
A: Immunoblots of single-dimension SDS-PAGE (lanes 1, 2) and two-dimensional PAGE (lanes 3, 4) profiles of human serum (lanes 1, 3) and recombinant (lanes 2, 4) PON. The arrows are molecular mass markers of, respectively from bottom to top, 22, 35, 45, and 66 kDa. B: Immunoblots of single-dimension SDS-PAGE of sera from AAMM (lanes 1, 2) and AALL (lanes 3, 4) subjects after incubation for 3 days at 37°C. Lane 5 is fresh serum. The arrows are molecular mass markers of, respectively, from bottom to top, 22, 35, and 45 kDa. Immunoblots were developed with monoclonal anti-PON antibody (1).
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 2.
Fast protein liquid chromatographic analysis of human serum (0.5 ml) and culture medium (0.5 ml) conditioned by PON-secreting CHO cells. The serum eluants were analyzed for total cholesterol and PON activity. The culture medium eluants were analyzed for PON activity. Western blot analysis confirmed that PON protein was present only in tubes showing enzyme activity. The arrows show the peak elution tubes for 1: VLDL/LDL, 2: HDL, 3: albumin. CM, culture medium PON activity; serum, serum PON activity.
|
|
Medium containing fetal calf serum conditioned either with the L or M type isoforms of PON was incubated at 37°C, and PON enzymatic activity followed. The M isoform lost activity more rapidly than the L isoform. Over a 96-h period, the M isoform lost a significantly greater percentage of enzyme activity than the L isoform when measured as arylesterase activity ( Fig 3A and Fig B; P < 0.01, n = 6). A similar result was obtained with paraoxon as substrate (P < 0.01, n = 6) (Fig 3B). To analyze the effect of human serum, the study was repeated with culture medium containing 10% PON-free human serum. The M isoform again lost activity more rapidly and to a greater extent than the L isoform (Fig 3C). One potential explanation for the observations is loss of activity due to proteolysis. To examine this possibility, complementary studies analyzed loss of activity during incubation with and without the proteolysis inhibitor, aprotinin. Under these conditions (Fig 3B and Fig C), both isoforms retained >90% of initial activities over a 96-h incubation period. Similarly, when samples were frozen for the duration of the incubation period in the absence of protease inhibitor, no loss of activity was evident (results not shown).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 3.
Enzyme activities of recombinant forms of PON. A: Activity toward phenylacetate in conditioned medium incubated at 37°C. Results (n = 4) are expressed as the percentage of activity at time 0 (when the medium was removed from the cells). B: Percentage loss of phenylacetate and paraoxon hydrolytic activities after incubation (96 h, 37°C) of conditioned medium (n = 6). C: Percentage loss of paraoxon and phenylacetate hydrolytic activities after incubation (96 h, 37°C) of conditioned medium (n = 6) containing 10% human serum. * P < 0.01 for L versus M under same incubation conditions. Test, no inhibitor; Inhibitor, containing aprotinin.
|
|
The relevance of the observations to serum PON was examined in a third series of studies. Serum samples were obtained from subjects who were homozygous LL or MM at the L54M polymorphic site and homozygous QQ at the Q191R polymorphic site. Fig 4 shows enzyme activities and concentrations of PON after incubation of the serum samples at 37°C. There was a gradual decrease in PON (Fig 4A) and arylesterase (Fig 4B) enzyme activities. However, the decrease was more pronounced in the sera from the MM homozygotes who lost PON significantly more rapidly than the LL samples (P < 0.01). Serum concentrations of PON were also analyzed in this study (Fig 4C). These confirmed a decrease in measurable PON protein mass, complimenting the observations on enzyme activities. To determine whether proteolytic fragments were detectable, the samples were also analyzed by SDS-PAGE (Fig 1B). This revealed the presence of a molecular mass band of approximately 35 kDa, which was distinct from the 42;46 kDa (Fig 1B, lane 5) of intact PON. The 35-kDa band was more evident in the samples from M allele carriers (Fig 1B, lanes 1, 2) than L allele carriers (Fig 1B, lanes 3, 4). No bands of smaller molecular mass could be detected (Fig 1B).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4.
PON enzyme activity with paraoxon (A), phenylacetate (B), and PON mass concentration (C) in sera from LL and MM homozygotes incubated under at 37°C. Results (n = 3 subjects) are expressed as the percentage of activity at day 0. D: Enzyme (PON) activity in HDL isolated from LL and MM homozygotes after incubation at 37°C for 24 h. Results are means ± SD (n = 3 subjects). Control, activity before incubation; inhib, activity after incubation for 24 h with aprotinin + kallikrein; kallikrein, activity after incubation for 24 h with kallikrein. * P < 0.01, ** P < 0.001.
|
|
The effects of the incubation conditions on HDL were also examined by agarose gel electrophoresis and SDS-PAGE under nonreducing conditions. Fig 5a shows agarose gel profiles of serum (lanes 1, 2) and culture medium containing human HDL (lanes 3, 4). Compared to serum maintained at 4°C (lane 1), serum incubated at 37°C (lane 2) showed negligible changes in HDL electrophoretic mobility, although there was an increase in migration of LDL. Incubation of HDL at 37°C in culture medium (lane 4) did not modify its electrophoretic mobility compared with control HDL (lane 3). These results concur with those of SDS-PAGE analyses of apoA-I (Fig 5b). Immunoblotting showed the predominant band to be monomeric apoA-I in culture medium maintained at 4°C (lane 1) or 37°C (lane 2), or serum at 4°C (lane 3) or 37°C (lane 4). There was no evidence for extensive cross-linking to form higher molecular mass complexes. These results suggest no extensive modifications to HDL lipid or protein components during the incubation periods at 37°C.


View larger version (161K):
[in this window]
[in a new window]
|
Figure 5.
A: Lipid-stained agarose gel profiles of human serum (lanes 1, 2) and culture medium containing human HDL (lanes 3, 4) after incubation at 4°C (lanes 1, 3) or 37°C for 4 days (lanes 2, 4). The arrow indicates the origin. B: Immunoblots of culture medium containing human HDL (lanes 1, 2) and human serum (lanes 3, 4) after incubation at 4°C (lanes 1, 3) or 37°C for 4 days (lanes 2, 4). After SDS-PAGE (nonreducing conditions), the profiles were electrotransferred to nitrocellulose and probed with anti-apoA-I antibodies. The band corresponds to monomeric apoA-I. The arrows show the locations of AII: apoA-II, AI: apoA-I, and Alb: albumin.
|
|
To examine more directly the influence of proteolysis on PON activity, HDL was isolated from MM and LL sera and incubated at 37°C together with the protease kallikrein, with and without the inhibitor, aprotinin. The results (Fig 4D) paralleled those obtained with conditioned medium and whole serum. The M isoform lost activity to a greater extent than the L isoform (P < 0.01) in the presence of kallikrein, whereas inhibition of the protease prevented loss of activity from both samples.
 |
DISCUSSION |
|---|
Data from in vitro studies and animal models provide firm support for the contention that variations in the PON content of HDL influence the ability of the lipoprotein to protect LDL from oxidative modifications. There is considerable within-population variation in serum PON levels. Our recent studies have demonstrated that there is undoubtedly a strong genetic component to these variations (16), but it cannot entirely explain the interindividual differences. Nongenetic factors appear to play a role. A significant positive correlation between serum HDL and PON concentrations (12) suggests an influence of the lipoprotein on PON levels, confirmed by our recent study showing substantial decreases in PON activities and concentrations in patients with HDL deficiencies (14). The present study focused on isoforms arising from the coding region polymorphism L54M. In initial studies, we linked the polymorphism to variations in serum concentrations of the enzyme (13); our more recent observations suggested that it was due to linkage disequilibrium with promoter polymorphisms (16). In subsequent analyses, however, we found that the L54M polymorphism remained significantly associated with variations in serum PON independently of promoter polymorphisms, as revealed in this study. It led us to examine the relative stability of the L and M isoforms as one possible explanation for this observation.
In the first instance, we adopted a strategy whereby the isoforms were secreted into a standardized medium, thus ensuring a uniform background against which the studies were performed. This eliminated potential confounding factors arising from the use of serum as a source of PON. Interindividual variations in serum composition and, more importantly, the composition of the serum transport vehicle, HDL, could independently influence PON isoform stability. We wished also to avoid PON purified from serum, as it necessitates vigorous procedures that denature the enzyme to a certain extent. The present study employed (for the initial studies) recombinant PON corresponding to the L and M isoforms with the same nucleotide at a second coding region polymorphic site (191), which is known to affect enzyme activity. The single- and two-dimensional PAGE profiles of the recombinant PON strongly resembled those of human serum PON, indicating that processing of the enzyme, notably with respect to glycosylation, followed that of the native peptide. The recombinant peptides were enzymatically active toward phenylacetate and paraoxon, showing relative activities similar to that of human serum PON, and were recognized by a monoclonal antibody raised against human PON. Finally, PON formed complexes with HDL in the conditioned medium, as shown by FPLC and confirmed by immunoaffinity chromatography.
The data from the initial study quite clearly show that the M isoform lost activity more rapidly and to a greater extent than the L isoform. This was a consistent observation and gave rise to an approximately 2-fold greater loss of activity after incubation. Human serum was employed in some studies to give a medium more closely corresponding to native conditions; in particular, the presence of human HDL. Even in this experimental setting, the M isoform was less stable than the L isoform. As one possible explanation for the observations, we examined the relative susceptibilities of the two isoforms to proteolysis. To investigate this possibility, studies were repeated in the presence of a protease inhibitor. Under these conditions, loss of PON enzyme activity was largely abolished for both isoforms. This strongly suggested that the basis for the differential loss of enzyme activity is greater susceptibility of the M isoform to proteolysis by enzymes present in the culture medium.
To examine more precisely this possibility, we made use of serum PON in HDL isolated by ultracentrifugation from donors who were homozygous LL or MM. This enabled us to analyze directly the impact of the serum proteolytic enzyme, kallikrein. The results confirmed those outlined above. Namely, the M54 isoform was more susceptible to loss of activity in the presence of kallikrein. The specific effect of the proteolytic enzyme was confirmed by showing full retention of PON activity when kallikrein was first inhibited by preincubation with aprotinin prior to addition to HDL-PON. In light of these results, we examined the stability of PON isoforms in whole serum. This provided a third approach whereby ultracentrifugation and formation of PON-HDL complexes under in vitro conditions were eliminated. It is possible that these nonphysiological manipulations could be responsible for the greater susceptibility of the M isoform to proteolysis. The results were consistent with those obtained using recombinant PON and HDL-PON. The M54 isoform lost activity more rapidly and to a greater extent than the L isoform. In addition, we demonstrated that loss of activity was accompanied by loss of measurable PON protein mass, consistent with the action of a proteolytic enzyme. Further analysis revealed the appearance of a smaller molecular mass band than intact PON, consistent with proteolysis of the enzyme.
The nucleotide polymorphism at the 54 position induces a methionine-leucine interchange. This is a conservative alteration, which would not be expected to alter susceptibility to proteolysis at this site. It may, however, induce conformational changes elsewhere in the peptide, making it more amenable to proteolytic degradation perhaps by modifying its ability to complex with HDL.
One important consideration is the potential physiological relevance of the observations. In the present study, we did not compare the antioxidant capacity of HDL after proteolysis. There appear to be several mechanisms by which HDL can protect LDL from oxidation (22). Proteolysis could also affect these mechanisms and, thus, it is not possible to attribute any decreased antioxidant effect unambiguously to the effect on PON. However, there is strong evidence in the literature to support the contention that modulating the PON content of HDL influences the antioxidant function of the lipoprotein. In animal models, the level of serum HDL-PON has been positively correlated with the degree of protection of LDL from oxidation (10) (11) (23). In vitro studies have shown that the ability to prevent oxidation of LDL correlates with the PON content of HDL (5) (9) (24), whereas Aviram et al. (25) reported that lipid peroxidation induced in whole serum and isolated HDL correlated negatively with the PON level. Several studies have also shown a dose-dependent inverse correlation between PON (as measured by enzyme activity) and the levels of lipid peroxides (9) (25) (26). Finally, in a recent study (27), we demonstrated specifically that varying the PON content of HDL modulated its protective role. We observed incremental decreases in copper-induced oxidation of LDL with increases in the PON content of HDL. The latter study also showed that variations in PON concentrations of 10;20% (similar to that due to proteolysis in the present study) were sufficient to decrease the antioxidant capacity of HDL. A second consideration is whether the time-course for the proteolytic effect is sufficient to influence serum PON concentrations in vivo. There are at present no data on PON turnover. However, the residence time of HDL in serum, determined from apoA-I kinetics, is 4;5 days (28), whereas we observed a significant impact of proteolysis on PON within 4 days. These time scales are compatible with the suggestion that proteolysis could have an influence on serum PON concentrations in vivo.
In conclusion, the results are consistent with the hypothesis that differences in serum levels of PON linked to the L54M polymorphism are due to reduced stability of the M isoform arising from its greater susceptibility to proteolysis. The observations have several implications. First, they provide a further explanation for the wide range of PON activities observed in human sera. Second, they indicate that knowledge of both the L54M and Q191R genotypes is of clinical and functional relevance. Third, the results have implications for the antioxidant capacity of HDL that is of importance in the cardiovascular field, given the reported association of PON with risk of vascular disease. Finally, the observations are relevant to the toxicology field, as PON offers a measure of protection against various environmental poisons.
 |
ACKNOWLEDGMENTS |
|---|
The study was supported by grants from the Swiss National Science Foundation (No. 31-453731.98), the Swiss Cardiology Foundation, the Gustave Prévot Foundation, and the Sandoz-Stiftung. The technical expertise of Barbara Kalix and Katia Galan is greatly appreciated.
Manuscript received June 26, 2000; and in revised form November 13, 2000
Abbreviations:
apo, apolipoprotein; CHO, Chinese hamster ovary; HDL, high density lipoprotein; LDL, low density lipoprotein; PON, paraoxonase; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis
 |
REFERENCES |
|---|
- Blatter, M-C, James, R. W., Messmer, S., Barja, F., Pometta, D. 1993. Identification of a distinct human high-density lipoprotein subspecies defined by a lipoprotein-associated protein, K-45. Identity of K-45 with paraoxonase. Eur. J. Biochem. 211:871-879[Medline].
- La Du, B. N. 1992. Human serum paraoxonase/arylesterase. In Pharmacogenetics of Drug Metabolism. W. Kalow, editor. Pergamon Press, New York. 51;91.
- Davis, H. G., Richter, R. J., Keifer, M., Broomfield, C. A., Sowalla, J., Furlong, C. E. 1996. The effect of the human serum paraoxonase polymorphism is reversed with diazoxon, soman and sarin. Nature Genet. 14:334-336[Medline].
- Mackness, M. I., Arrol, S., Durrington, P. N. 1991. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett. 286:152-154[Medline].
- Watson, A. D., Berliner, J. A., Hama, S. Y., La Du, B. N., Faull, K. F., Fogelman, A. M., Navab, M. 1995. Protective effect of high density lipoprotein associated paraoxonase. Inhibition of the biological activity of minimally oxidised low density lipoprotein. J. Clin. Invest. 96:2882-2891.
- Berliner, J. A., Navab, M., Fogelman, A. M., Frank, J. S., Demer, L. L., Edwards, P. A., Edwards, A. D., Lusis, A. J. 1995. Atherosclerosis: basic mechanisms. Oxidation, inflammation, and genetics. Circulation. 91:2488-2496[Abstract/Free Full Text].
- Steinberg, D. 1997. Low density lipoprotein oxidation and its pathobiological significance. J. Biol. Chem. 272:20963-20966[Free Full Text].
- Ross, R. 1999. Atherosclerosis an inflammatory disease. N. Engl. J. Med. 340:115-126[Free Full Text].
- Van Lenten, B. J., Hama, S. Y., de Beer, F. C., Stafforini, D. M., McIntyre, T. M., Prescott, S. M., La Du, B. N., Fogelman, A. M., Navab, M. 1995. Anti-inflammatory HDL becomes pro-inflammatory during the acute phase response. Loss of protective effect of HDL against LDL oxidation in aortic wall cell cocultures. J. Clin. Invest. 96:2758-2767.
- Shih, D. M., Gu, L., Hama, S., Xia, Y-R., Navab, M., Fogelman, A. M., Lusis, A. J. 1996. Genetic-dietary regulation of serum paraoxonase expression and its role in atherogenesis in a mouse model. J. Clin. Invest. 97:1630-1639[Medline].
- Shih, D. M., Gu, L., Xia, Y-R., Navab, M., Li, W-F., Hama, S., Castellani, L. W., Furlong, C. E., Costa, L. G., Fogelman, A. M., Lusis, A. J. 1998. Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature. 394:284-287[Medline].
- Blatter Garin, M. C., Abbot, C., Messmer, S., Mackness, M. I., Durrington, P. N., Pometta, D., James, R. W. 1994. Quantification of human serum paraoxonase by enzyme-linked immunoassay: population differences in protein concentrations. Biochem. J. 304:549-554.
- Blatter Garin, M. C., James, R. W., Dussoix, P., Blanché, H., Passa, P., Froguel, P., Ruiz, J. 1997. Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentrations of the enzyme. A possible link between the paraoxonase gene and increased risk of cardiovascular disease in diabetes. J. Clin. Invest. 99:62-66[Medline].
- James, R. W., Blatter Garin, M. C., Calabresi, L., Miccoli, R., von Eckardstein, A., Tilly-Kiesi, M., Taskinen, M-R., Assmann, G., Franceschini, G. 1998. Modulated serum activities and concentrations of paraoxonase in high density lipoprotein deficiency states. Atherosclerosis. 139:77-82[Medline].
- Leviev, I., Negro, F., James, R. W. 1997. Two alleles of the human paraoxonase gene produce different amounts of mRNA: an explanation for differences in serum concentrations of paraoxonase associated with the (Leu-Met54) polymorphism. Arterioscler. Thromb. Vasc. Biol. 17:3935-3939.
- Leviev, I., James, R. W. 2000. Promoter polymorphisms of the human paraoxonase PON1 gene and serum paraoxonase activities and concentrations. Arterioscler. Thromb. Vasc. Biol. 20:516-521[Abstract/Free Full Text].
- Ruiz, A., Bhat, S. P., Bok, D. 1995. Characterization and quantification of full-length and truncated Na,K-ATPase alpha 1 and beta 1 RNA transcripts expressed in human retinal pigment epithelium. Gene. 155:179-184[Medline].
- James, R. W., Hochstrasser, D., Tissot, J-D., Funk, M., Appel, R., Barja, F., Pellegrini, C., Muller, A. F., Pometta, D. 1988. Protein heterogeneity of lipoprotein particles containing apolipoprotein A-I without apolipoprotein A-II and apolipoprotein A-I with apolipoprotein A-II, isolated from human plasma. J. Lipid Res. 29:1557-1571[Abstract].
- Hassett, C., Richter, R. J., Humbert, R., Chapline, C., Crabb, J. W., Omiecinski, C. J., Furlong, C. E. 1991. Characterization of cDNA clones encoding rabbit and human serum paraoxonase: the mature protein retains its signal sequence. Biochemistry. 30:10141-10149[Medline].
- Havel, R. J., Eder, H. A., Bragton, J. H. 1955. The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J. Clin. Invest. 34:1345-1353.
- Adkins, S., Gan, K. N., Mody, M., La Du, B. N. 1993. Molecular basis for the polymorphic forms of human serum paraoxonase/arylesterase: glutamine or arginine at position 191, for the respective A or B allozymes. Am. J. Hum. Genet. 52:598-608[Medline].
- Barter, P. J., Rye, K. A. 1996. High density lipoproteins and coronary heart disease. Atherosclerosis. 121:1-12[Medline].
- Castellani, L. W., Navab, M., Van Lenten, B. J., Hendrick, C. C., Hama, S. Y., Goto, A. M., Fogelman, A. M., Lusis, A. J. 1997. Overexpression of apolipoprotein A-II in transgenic mice converts high density lipoproteins to pro-inflammatory particles. J. Clin. Invest. 100:464-474[Medline].
- Cao, H., Girard-Globa, A., Berthezene, F., Moulin, P. 1999. Paraoxonase protection of LDL against peroxidation is independent of its esterase activity towards paraoxon and is unaffected by the Q-R genetic polymorphism. J. Lipid Res. 40:133-139[Abstract/Free Full Text].
- Aviram, M., Rosenblat, M., Bisgaier, C. L., Newton, R. S., Primo-Parmo, S. L., La Du, B. N. 1998. Paraoxonase inhibits high-density lipoprotein oxidation and preserves its functions. A possible peroxidative role for paraoxonase. J. Clin. Invest. 101:1581-1590[Medline].
- Mackness, M. I., Arrol, S., Abbot, C., Durrington, P. N. 1993. Protection of low-density lipoprotein against oxidative modification by high-density lipoprotein associated paraoxonase. Atherosclerosis. 104:129-135[Medline].
- James, R. W., Leviev, I., Righetti, A. 2000. Smoking is associated with reduced serum paraoxonase activity and concentration in coronary artery disease patients. Circulation. 101:2252-2257[Abstract/Free Full Text].
- Marsh, J. B., Welty, F. K., Schaefer, E. J. 2000. Stable isotope turnover of apolipoproteins of high density lipoproteins in humans. Curr. Opin. Lipidol. 11:261-266[Medline].

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?