|
Journal of Lipid Research, Vol. 42, 1402-1412, September 2001
Copyright © 2001 by Lipid Research, Inc.
Nuclear receptor-mediated repression of human cholesterol 7 -hydroxylase gene transcription by bile acids
Wenling Chena,
Erika Owsleya,
Yizeng Yanga,
Diane Stroupa, and
John Y. L. Chianga
a Department of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of Medicine, Rootstown, OH 44272
Correspondence to:
Diane Stroup, Present address: Department of Chemistry, Kent State University, Kent, OH 44242.
 |
ABSTRACT |
|---|
Hydrophobic bile acids strongly repressed transcription of the human cholesterol 7 -hydroxylase gene (CYP7A1) in the bile acid biosynthetic pathway in the liver. Farnesoid X receptor (FXR) repressed CYP7A1/Luc reporter activity in a transfection assay in human liver-derived HepG2 cells, but not in human embryonic kidney (HEK) 293 cells. FXR-binding activity was required for bile acid repression of CYP7A1 transcription despite the fact that FXR did not bind to the CYP7A1 promoter. FXR-induced liver-specific factors must be required for mediating bile acid repression. Bile acids and FXR repressed endogenous CYP7A1 but stimulated -fetoprotein transcription factor (FTF) and small heterodimer partner (SHP) mRNA expression in HepG2 cells. Feeding of rats with chenodeoxycholic acid repressed CYP7A1, induced FTF, but had no effect on SHP mRNA expression in the liver. FTF strongly repressed CYP7A1 transcription in a dose-dependent manner, and SHP further inhibited CYP7A1 in HepG2 cells, but not in HEK 293 cells. FXR only moderately stimulated SHP transcription, whereas FTF strongly inhibited SHP transcription in HepG2 cells.
Results revealed that FTF was a dominant negative factor that was induced by bile acid-activated FXR to inhibit both CYP7A1 and SHP transcription. Differential regulation of FTF and SHP expression by bile acids may explain the wide variation in CYP7A1 expression and the rate of bile acid synthesis and regulation in different species. Chen, W., E. Owsley, Y. Yang, D. Stroup, and J. Y. L. Chiang. Nuclear receptor-mediated repression of human cholesterol 7 -hydroxylase gene transcription by bile acids. J. Lipid Res. 2001. 42: 1402;1412.
Supplementary key words:
bile acid synthesis, mechanism of gene regulation, cytochrome P450
 |
INTRODUCTION |
|---|
Conversion of cholesterol to bile acids occurs exclusively in the liver and is regulated by the rate-limiting enzyme cholesterol 7 -hydroxylase, which is a product of the CYP7A1 gene (1). The rate of bile acid synthesis and CYP7A1 protein activity are feedback inhibited by bile acids returning to the liver via enterohepatic circulation of bile. Many lines of evidence have suggested that CYP7A1 transcription is inhibited by hydrophobic bile acids (2) (3) (4) (5). We have previously demonstrated that hydrophobic bile acids strongly repress CYP7A1 transcription, in transient transfection assays in confluent HepG2 cells, and identified a bile acid response element (BARE-II, nucleotides -148 to 118) (6) (7). This sequence contains a direct repeat of an AGGTCA-like motif separated by one base (DR1) that has been identified as a binding site for hepatocyte nuclear factor 4 (HNF4) (8). This HNF4 site overlaps with a binding site (TCAAGGCCA) for the NR5A2 family of monomeric nuclear receptors (9). NR5A2 receptors include rat -fetoprotein transcription factor (FTF) (9), mouse liver-related homolog (LRH) (9), human cholesterol 7 -hydroxylase promoter factor (CPF, and variants) (10), and human B1-binding factor (hB1F) (11).
Farnesoid X receptor (FXR) is activated by hydrophobic bile acids such as chenodeoxycholic acid (CDCA) and deoxycholic acid (DCA) at physiological concentrations (12) (13) (14). Bile acid-activated FXR represses CYP7A1 transcription in transfection assays in HepG2 cells (12) (15). The potency of bile acid repression of the CYP7A1 gene correlates with the efficacy of bile acid activation of FXR. We have shown that FXR represses rat CYP7A1 transcription through the BARE-II, but FXR does not bind to this sequence (15). No FXR response element (inverted repeat with one-base spacing, IR1) has been found in CYP7A1. We suggest that FXR represses CYP7A1 transcription by an indirect mechanism involving other bile acid receptors in hepatocytes (15).
While this manuscript was in preparation, two laboratories reported that bile acids and FXR antagonist repressed CYP7A1 but stimulated small heterodimer partner (SHP) mRNA expression in mouse liver (16) (17). SHP is predominantly a negative nuclear receptor that interacts with FTF and inhibits CYP7A1 transcription. This is consistent with impaired bile acid synthesis and increased SHP mRNA expression in the fxr knockout mouse model (18). The objective of this research was to identify liver-specific factors that are induced by bile acids and mediate bile acid inhibition of regulatory genes in bile acid synthesis. We studied FXR-mediated bile acid repression of the human CYP7A1 gene and revealed a complex regulatory repertoire involving FXR induction of FTF, which functions as a negative factor that interacts with and regulates SHP and CYP7A1 transcription.
 |
EXPERIMENTAL PROCEDURES |
|---|
Materials
Human hepatocellular blastoma cells HepG2 (ATCC HB8065), human embryonic kidney (HEK) 293 cells (ATCC CRL1573), intestinal Caco-2, and Chinese hamster ovary (CHO) cells were obtained from the American Type Culture Collection (Rockville, MD). DMEM-F12 and trypsin-EDTA were purchased from Life Technologies (Rockville, MD). Penicillin G-streptomycin and fetal calf serum were from Celox (Hopkins, MN) and Irvine Scientific (Santa Ana, CA), respectively. Bile acids and their taurine conjugates were supplied by Sigma (St. Louis, MO). Restriction enzymes and other modifying enzymes were purchased from BRL (Bethesda, MD) or Promega (Madison, WI). Luciferase (Luc) reporter gene vectors pGL3 and the reagents for luciferase assays were purchased from Promega. The DNA purification kit was from Clontech (Palo Alto, CA). The double-stranded oligonucleotides were synthesized by Life Technologies. The RETROscript kit for RT-PCR was purchased from Ambion (Austin, TX). TRI reagent for RNA isolation was purchased from Sigma.
Methods
Reporter gene and receptor expression plasmids.
Human CYP7A1/Luc reporter gene, ph-1887/Luc and ph-372/Luc, and rat p-376/Luc were constructed as described previously (19) (20). An SHP/Luc reporter plasmid containing 2,080 bp of 5' upstream sequence of human SHP and a mouse IBABP/Luc reporter plasmid containing nucleotides - 496 to +40 of the gene encoding mouse ileum bile acid-binding protein (IBABP) were kindly provided by D. Moore (Baylor College of Medicine, Houston, TX). A mutant FXR (mFXR) lacking DNA-binding activity was constructed by changing Cys-179 of the Zn2+ finger of rat FXR to an arginine. This was based on the finding that mutation of the corresponding cysteine residue in HNF4 generated a dominant negative HNF4 mutant lacking DNA-binding activity (21). This cysteine-to-arginine conversion was accomplished by introducing a T C point mutation in the rat FXR sequence by PCR with the 3' mutagenic primer (GCACTTCCTTAGCCGGCGATCCTG, mutation in boldface, NaeI restriction site underlined), and the T7 sequencing primer (5' primer) (Promega), using pcDNA3FXR as a template. The resulting fragment was digested with KpnI and NaeI and was assembled into pcDNA3 cut with KpnI and BamHI, with the remainder of the FXR-coding region on an NaeI-BamHI fragment. The clones were screened for the mutation by detecting the created MboI restriction site by restriction digestion (aggattgccggc to aggatcgccggc; mutation in boldface, NaeI restriction site underlined).
Expression plasmid for human retinoid X receptor (pCMXhRXR ), rat FXR (pRSVFXR), human FXR (pcDNAhFXR), human liver Na+-taurocholate cotransporter protein (NTCP), mouse SHP (CDM8mSHP) and human FTF (CDM8FTF), and human CPF (pcDNA3CPF) were kindly provided by R. Evans (Salk Institute, La Jolla, CA), C. Weinberger (National Institute of Environmental Health Sciences, Research Triangle Park, NC), D. Mangelsdorf (UT Southwestern Medical School, Dallas, TX), P. Dawson (Wake Forest University, Winston-Salem, NC), D. Moore, and B. Shan (Tularik, South San Francisco, CA), respectively. Rat FXR was moved from pRSVFXR to pCDNA3 vector to generate pCDNA3-rFXR.
Cell culture and transient transfection assay.
HepG2 cells were cultured in DMEM-F12 (50:50) supplemented with 10% (v/v) heat-inactivated fetal calf serum, penicillin G (100 U/ml), and streptomycin (100 µg/ml). Cells were grown in 12-well plates to confluence in 3 to 4 days. Cells were grown in serum-free medium after transient transfection of DNA by the calcium phosphate DNA coprecipitation method. The amount of plasmid used was 2.5 µg of reporter and 0.5 µg of receptor expression plasmid in all assays, except in the dose-response study, in which various ratios of reporter to expression vector were used. In each assay, 0.5 µg of pCMVß-galactosidase was cotransfected as an internal standard for normalization of transfection efficiency. Four hours after transfection, cells were treated with bile acids or vehicle (ethanol). Cells were harvested 40 h later, washed twice with phosphate-buffered saline, and lysed with reporter lysis buffer (Promega). Luciferase activities were measured by luminometer and normalized by dividing the relative light units (RLU) by ß-galactosidase activity. Each assay was done in triplicate and each experiment was repeated at least three times. HEK 293 and CHO cells were transfected in the same method, except that CHO cells were plated 1 day before transfection. Statistic analyses were performed between treated and untreated control, using Student's t-test.
Determination of mRNA by RT-PCR.
HepG2, HEK 293, and CHO cells were grown in DMEM-F12 (50:50) supplemented with 10% (v/v) heat-inactivated fetal calf serum and penicillin G (100 U/ml) and streptomycin (100 µg/ml). Cells were grown in 25-cm2 flasks to confluence in 3 to 4 days. FXR and RXR expression plasmids (10 µg each) were transiently transfected by the calcium phosphate-DNA coprecipitation method. Empty plasmid, pcDNA3 for CPF, FXR, and RXR, or CDM8 for FTF and SHP, was transfected as a control, or added to compensate for the total amount of DNA used in each transfection assay. Cells were then treated with 25 µM cholic acid (CA) or CDCA 4 h after transfection and were harvested 40 h after treatment. Total RNAs were isolation with TRI reagent. A RETROscript kit (Ambion) was used to quantify, by RT-PCR, CYP7A1 mRNA levels in HepG2, HEK 293, and CHO cells. Total RNAs were primed with decamer provided in the kit and cDNA was synthesized by reverse transcriptase, followed by PCR with gene-specific primers. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Rig/S15 mRNAs were amplified as internal standards of PCR. Primer sets were designed to amplify a cDNA fragment containing sequences derived from two adjacent exons to distinguish them from potential PCR products due to contamination of genomic DNA in RNA preparations. Human FXR-specific primers were as follows: forward primer, 5'-CAGAATTCACAGTGAAGGTCGT GACTTGC-3'; reverse primer, 5'-GCGGTACCGTGGTGATGAT TGAATGTCC-3'. Human CYP7A1-specific primers were as follows: forward primer, 5'-GCATCATAGCTCTTTACCCAC-3'; reverse primer, 5'-GGTGTTCTGCAGTCCTGTAAT-3' (22). GAPDH primers were as follows: forward primer, 5'-CCATCACCATCTTC CAGGAG-3'; reverse primer, 5'-GGATGATGTTCTGAGAGCC-3'. The sizes of product amplified with the FXR, CYP7A1, GAPDH, and Rig/S15 primers (provided in the RETROscript kit) were 672, 416, 415, and 361 bp, respectively. These mRNAs could be detected by 20 cycles of PCR and were linear up to 30 cycles of PCR.
Determination of mRNA by Northern blot hybridization.
Female Sprague-Dawley CD rats were fed a diet supplemented with 1% CDCA for 2 weeks. Rats were housed in a room with a reversed light cycle (3 AM to 3 PM dark, and 3 PM to 3 AM light) and killed at 9 AM. Total and poly(A+) RNAs were isolated from livers, using an Ultraspec-II RNA isolation system (Biotecx, Houston, TX) and a poly(A+) Pure mRNA isolation kit (Ambion). HepG2 cells were grown to confluence in a 75-cm2 flask. Cells were transfected with 10 µg each of pcDNAhFXR and pcCMVhRXR by Tfx-20 reagent (ratio 1:3, w/v; Promega). Cells were treated with 25 µM CDCA 1 h after transfection and collected 40 h later for isolation of total RNA, using the Ultraspec-II RNA isolation system according to the manufacturer instructions. For Northern blot, 20 µg of total RNA was separated on a 1.2% formaldehyde agarose gel, transferred to Nylon plus filter (MSI, Westboro, MA), and hybridized with CYP7A1, mouse SHP, or human FTF cDNA labeled by the Klenow fragment of DNA polymerase I with [32P]dCTP. The same membrane was reused for hybridization with other probes after stripping out of radioactivity. Radioactivity was detected by PhosphorImager 445 SI (Molecular Dynamics, Sunnyvale, CA).
Electrophoretic mobility shift assay (EMSA).
Oligonucleotides were custom synthesized (upper strand indicated): human SHP (gatc GAGTTAaTGACCTgatc), mouse SHP (gatcGGGTTAaTGAC CCgatc), and FTF-binding sites (underlined) of rat CYP7A1 (gatc GTTCAAGGCCAGTTACTACCAgatc) and human CYP7A1 (gatGT TCAAGGCCGGGTAATGCTAgatc). Double-stranded synthetic probes for EMSA were prepared by heating equal molar amounts of complementary synthetic oligomers to 100°C in 2x SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), holding at 88°C for 10 min, and then allowing the hybridization mix to cool to ambient temperature in a heating block. The resulting double-stranded fragments were end labeled by incorporating [32P]dCTP (3,000 Ci/mol) with the Klenow fragment of DNA polymerase I. Oligonucleotides blunted with nonlabeled dNTPs were used as unlabeled competitors in EMSA. Labeled fragments were isolated from a 15% polyacrylamide gel. DNA-binding reactions were initiated by the addition of 100,000 cpm of the probe to protein. Reaction mixtures (20 µl) were preincubated with 1 µg of poly(dI-dC)·poly(dI-dC) and 40 pmol of single-stranded synthetic oligomer dissolved in 1x gel shift buffer (containing 12 mM HEPES, pH 7.9, 50 mM KCl, 1 mM EDTA, 1 mM DTT, and 15% glycerol) in a 20 µl reaction mixture, and incubated for 30 min at 25°C. FXR, RXR , SHP, and CPF were synthesized in vitro with a Quick Coupled Transcription/Translation system (Promega) according to the manufacturer instructions. Samples were run on 4% polyacrylamide gels, dried, autoradiographed by PhosphorImaging, and quantified with IP Lab Gel software (Signal Analytics, Vienna, VA).
 |
RESULTS |
|---|
Effect of bile acids, liver bile acid transporter, and FXR/RXR on human CYP7A1/Luc reporter activity in HepG2 cells
We reported previously that physiological concentrations of bile acids were able to inhibit rat CYP7A1 transcription in HepG2 cells and that cotransfection with FXR enhanced bile acid repression (15). Here we have carried out a detailed study of bile acid inhibition of human CYP7A1/Luc reporter activity. As shown in Fig 1a, physiological (25 µM) concentrations of DCA and CDCA significantly suppressed the human CYP7A1/Luc reporter activity by 30% and 50%, respectively, in HepG2 cells. Nonphysiological concentrations up to 75 µM completely inhibited reporter activity (data not shown). Less hydrophobic bile acid, CA, and hydrophilic bile acid, ursodeoxycholic acid (UDCA), had no significant effect on reporter activity. All taurine-conjugated bile acids tested, including taurocholic acid (TCA), taurodeoxycholic acid (TDCA), taurochenodeoxycholic acid (TCDCA), tauroursodeoxycholic acid (TUDCA), and taurolithocholic acid (TLCA), had no effect. When liver bile acid transporter NTCP was cotransfected in HepG2 cells, all taurine-conjugated bile acids significantly repressed reporter activity. Cotransfection of NTCP did not significantly affect the inhibitory action of DCA and CDCA. Apparently taurine-conjugated bile acids require bile acid transporter for transport, whereas hydrophobic bile acids were able to diffuse into HepG2 cells (7). When cotransfected with the FXR/RXR expression vectors (5:1 ratio of reporter to receptor plasmid), CYP7A1 reporter activity was repressed 50%. This is in contrast to the stimulatory effect of FXR on rat CYP7A1 (15). Addition of 25 µM DCA, CDCA, TDCA, TCDCA, or TLCA further repressed human CYP7A1/Luc reporter activity up to 80%. When cotransfected with both FXR/RXR and NTCP, all bile acids except UDCA and TUDCA further suppressed CYP7A1/Luc reporter activity. Therefore, hydrophobic bile acids strongly repress human CYP7A1 transcription, and overexpression of FXR further represses reporter activity in HepG2 cells. This indicates that bile acid repression of CYP7A1 is mediated either by endogenous FXR or by other factors activated by bile acid in liver cells.


View larger version (116K):
[in this window]
[in a new window]
|
Figure 1.
Effects of bile acids, liver bile acid transporter, and FXR/RXR on human CYP7A1 transcription. A: Transfection assays in HepG2 Cells. HepG2 cells were cultured to confluence. Bile acids (CA, DCA, CDCA, and UDCA) and their taurine conjugates (TCA, TDCA, TCDCA, TUDCA, and TLCA) (25 µM) were added individually to HepG2 cells transfected with human CYP7A1 (-1887)/Luc plasmid containing 1,887 bp of 5' upstream sequence, with or without cotransfection with NTCP, FXR/RXR , or FXR/RXR /NTCP and treated with the indicated bile acids. Cultures were harvested 40 h later for assay of luciferase activity as described in Experimental Procedures. Ethanol was used as a vehicle for delivery of bile acids. Error bars indicate standard errors of the means of triplicate assays. Graph shown is a representation of three separate experiments. CA, Cholic acid; DCA, deoxycholic acid; CDCA, chenodeoxycholic acid; UDCA, ursodeoxycholic acid; TCA, tauro-CA; TDCA, tauro-DCA; TCDCA, tauro-CDCA; TUDCA, tauro-UDC; TLCA, taurolithocholic acid. B: Transfection assays in HEK 293 cells. HEK 293 cells were cultured to confluence, transfected with the CYP7A1 (-1887)/Luc construct with or without cotransfection with NTCP, FXR/RXR , or FXR/RXR /NTCP, and treated with the indicated bile acids (25 µM). Experiments and analysis were the same as in (A). The asterisk (*) indicates a significant difference (P < 0.05) from vehicle (ethanol) by bile acid treatment. The symbols # and + indicate a significant difference (P < 0.05) from control (open columns) by transfection with FXR/RXR and NTCP/FXR/RXR , respectively. The symbols ## and indicate a significant difference (P < 0.05) from vehicle by bile acid treatment when transfected with FXR/RXR and NTCP/FXR/RXR , respectively.
|
|
To test whether the bile acid effect on CYP7A1 transcription is liver specific, we performed the same experiments in HEK 293 cells (Fig 1b). In contrast to the results obtained in HepG2 cells, these bile acids did not inhibit reporter activity, with or without cotransfection with FXR and/or NTCP. This is consistent with our previous observation that bile acid inhibition of CYP7A1 transcription is liver specific (20). It appears that liver-specific factors other than FXR were required for bile acid inhibition.
DNA-binding activity of FXR was required for FXR-mediated regulation of gene transcription
As a positive control, effects of FXR and CDCA on IBABP transcription were studied in HepG2 cells and also in intestinal Caco-2 cells, using the same transfection system for studying CYP7A1 transcription. An mFXR, with a cysteine residue of the Zn2+ finger converted to an arginine, was obtained by mutagenesis. This mFXR was not able to bind to an IR1 probe, whereas the wild-type FXR forms a heterodimer with RXR and bound strongly to the probe ( Fig 2a). Fig 2b shows that cotransfection with FXR strongly stimulated human IBABP/Luc reporter activity by about 10-fold in HepG2 cells. Addition of 25 µM CDCA further stimulated IBABP reporter activity to 32-fold. The mFXR had no effect on IBABP reporter activity, indicating that DNA-binding activity of FXR was required for the transactivation of IBABP. DNA-binding activity of FXR was also required for the enhancement of the bile acid repression of both rat and human CYP7A1/Luc reporter activity in HepG2 cells (Fig 2c). Wild-type FXR stimulated rat but inhibited human CYP7A1, as we observed previously (15). Addition of CDCA resulted in enhanced repression of both rat and human CYP7A1. On the other hand, the mFXR had no effect on rat or human CYP7A1/Luc reporter activity. These results could be explained by FXR being a positive transcription factor that stimulates rat CYP7A1 via binding to a DR4 in the BARE-I, as reported previously (15). Activation of FXR by bile acids may upregulate a negative factor or downregulate a positive factor, thus indirectly repressing CYP7A1 transcription in hepatocytes. Human CYP7A1, which lacks the DR4, was repressed by FXR and bile acids, consistent with the indirect mechanism we have proposed (15). In intestinal Caco-2 cells (Fig 2d), wild-type FXR stimulated IBABP reporter activity by 4-fold, and addition of CDCA dramatically stimulated IBABP reporter activity by 149-fold. In contrast, rat CYP7A1/Luc reporter was not regulated by CDCA and FXR in Caco-2 cells, consistent with a mechanism in which bile acid repression requires the induction of liver-specific factors by bile acids.




View larger version (179K):
[in this window]
[in a new window]
|
Figure 2.
Effects of CDCA, FXR, and mFXR lacking DNA-binding activity on IBABP/Luc and CYP7A1/Luc reporter activity. A: Electrophoretic mobility shift assay of FXR, mFXR, and/or RXR probed with a perfect IR1 oligonucleotide labeled with 32P. RRL, rabbit reticulocyte lysate. B: Human IBABP/Luc reporter plasmid was transfected into HepG2 cells. FXR/RXR expression plasmids (0.5 µg each), mFXR, or control plasmid pcDNA3 was cotransfected as indicated. CDCA (25 µM) or vehicle (ethanol) was added as indicated. The percentages indicate the effect of CDCA, relative to vehicle, in the same group. All groups showed a significant difference with CDCA (P < 0.05). C: Rat CYP7A1 (p-376/Luc) or human CYP7A1 (ph-372/Luc) reporter plasmid was cotransfected into HepG2 cells with pcDNA3, FXR/RXR , or mFXR/RXR as indicated. CDCA (25 µM) or vehicle (ethanol) was added as indicated. CDCA significantly reduced reporter activity in each group (P < 0.05). D: Caco-2 cells were used for the transfection assay. The IBABP/Luc or rat p-376/Luc reporter plasmid was cotransfected with FXR/RXR expression plasmids. The pcDNA3 plasmid was used as a control. CDCA (25 µM) or vehicle (ethanol) was added as indicated. X, Fold change by CDCA. Other groups are not altered significantly by CDCA treatment. Experimental procedures and analysis of data are the same as in Fig 1. ** Statistically significant difference (P < 0.005) compared with vehicle.
|
|
Effect of bile acids and FXR/RXR on CYP7A1 and FXR mRNA expression levels
To study the effect of FXR and bile acids on human CYP7A1 mRNA expression, we transfected HepG2 cells with FXR expression plasmid and measured CYP7A1 mRNA expression levels. Endogenous FXR and CYP7A1 mRNA levels in HepG2 cells were too low to be detected by hybridization. Therefore, RT-PCR was used. As shown in Fig 3a, endogenous FXR mRNA in HepG2 cells could be detected by 25 cycles of amplification. Transfection with FXR/RXR increased FXR mRNA expression in HepG2 cells by about 3-fold. Transfection with FXR/RXR suppressed CYP7A1 mRNA expression by about 50%. Addition of 25 µM CA further reduced CYP7A1 mRNA by 80%. CDCA (25 µM) completely inhibited CYP7A1 mRNA expression. FXR mRNA was not detected in HEK 293 and CHO cells (Fig 3b) and was highly expressed by transfection with FXR/RXR because of the high transfection efficiency of these two cell lines. These results demonstrated that bile acids and FXR strongly repressed CYP7A1 mRNA expression in HepG2 cells.


View larger version (74K):
[in this window]
[in a new window]
|
Figure 3.
RT-PCR analysis of the effect of FXR and bile acids on CYP7A1 and mRNA expression levels in HepG2 cells. A: HepG2 cells were cultured to confluence, transfected with FXR/RXR , and treated with 25 µM CA or CDCA or vehicle (ethanol). Control was transfected with pcDNA3 empty plasmid. Forty hours later, the cells were harvested and used for isolation of RNA. RT-PCR was performed as described in Experimental Procedures. B: FXR mRNA expression in HepG2, HEK 293, and CHO cells. HepG2, HEK 293, and CHO cells were cultured to confluence, transfected with or without FXR/RXR (F/R), and treated with 25 µM CDCA. Forty hours later, the cells were harvested and used for RNA isolation. RT-PCR (25 cycles) was performed as described in Experimental Procedures.
|
|
Effect of bile acids and FXR on FTF and SHP mRNA expression in HepG2 cells and rat livers
Because FTF and SHP have been implicated in the regulation of CYP7A1 transcription, effects of FXR and bile acids on FTF and SHP mRNA expression in HepG2 cells were studied. Fig 4a shows FTF and SHP mRNA expression in HepG2 cells by mRNA hybridization. The endogenous FTF and SHP mRNA levels in HepG2 cells were low. When CDCA (25 µM) was added, two FTF mRNA transcripts were induced by about 2-fold, but SHP mRNA was not increased. When HepG2 cells were transfected with FXR/RXR , FTF mRNA levels were increased 8.5-fold in comparison with the untreated control, and SHP mRNA was increased by 2.3-fold.
We also studied the effect of bile acid feeding on FTF and SHP mRNA expression in rat livers (Fig 4b). As a positive control, feeding of rats with 1% CDCA for 2 weeks repressed CYP7A1 mRNA expression by 70%. To detect FTF or SHP mRNA, poly(A+) RNA was used for hybridization. Feeding of CDCA strongly stimulated FTF mRNA expression by 7-fold. Three FTF transcripts were detected in rat livers. However, CDCA did not affect SHP mRNA expression in rat livers. This is in contrast to the strong induction of SHP mRNA expression by 7-fold, but no effect on LRH-1 mRNA, in mouse livers (16).
Effects of FTF and SHP on CYP7A1/Luc reporter activity
Because FTF and SHP are induced by bile acids and FXR, these two nuclear receptors might directly inhibit CYP7A1 transcription. Therefore, the effects of FTF and SHP on human CYP7A1/Luc reporter activities in HepG2 cells were studied. In our transfection assay, a reporter plasmid (2.5 µg)-to-receptor plasmid (0.5 µg) ratio of 5 to 1 was routinely used to avoid possible artifacts caused by a large excess of receptor expressed. Transfection with FTF repressed human CYP7A1/Luc reporter activity by 50%, but CPF had less effect on reporter activity ( Fig 5a). FTF (541 amino acid residues) and CPF (495 amino acid residues) may have different activity due to differences in the N-terminal sequences. When SHP and CPF or FTF were cotransfected, reporter activity was repressed by about 70% to 80%.
When the same assays were done in HEK 293 cells (Fig 5b), FTF slightly stimulated reporter activity. CPF significantly stimulated reporter activity by 2-fold, similar to that observed by Nitta et al. (10). Interestingly, cotransfection of SHP with FTF or CPF did not repress reporter activity. Again, this illustrates that regulation of CYP7A1 transcription by bile acids and nuclear receptors is a liver-specific event.
Fig 5c shows that FTF strongly repressed CYP7A1 reporter activity in a dose-dependent manner, and addition of SHP synergistically repressed the activity in HepG2 cells. This dose-dependent inhibitory effect was not observed when assays were done in 293 cells (Fig 5d). Thus FTF had a dominant negative effect on human CYP7A1 transcription in HepG2 cells.
EMSA of FXR binding to SHP and of CPF binding to CYP7A1
Because FXR and CDCA stimulated SHP mRNA expression in HepG2 cells, FXR may bind to the SHP gene and activate SHP transcription. We analyzed the 5' upstream sequence of the SHP gene and identified a putative IR1 sequence in both mouse SHP (-329GGGTTAaTGACCC-317) and human SHP (-291GAGTTAaTGACCT-279) promoters. To test whether these IR1 sequences bind FXR, we performed an EMSA. As shown in Fig 6a, in vitro-synthesized FXR/RXR heterodimer bound to the putative IR1 sequence of human SHP relatively weakly as compared with a positive control, an IR1 sequence of a well-characterized gene encoding ecdysone heat shock protein 27. This result is consistent with that reported by Goodwin et al. (17). The weak binding of FXR to SHP is consistent with the weak stimulatory effect of CDCA and FXR on SHP mRNA expression in HepG2 cells and no effect in rat livers shown in Fig 4.
An EMSA using in vitro-synthesized CPF was also probed with putative FTF-binding sequences in rat and human CYP7A1. The FTF-binding site, 136TCAAGGCCA-128 (human), is located in the BARE-II region. There is a single base substitution of G for A at the 3' end of the corresponding rat FTF site. As shown in Fig 6b, both human and rat FTF-binding sites strongly bound in vitro-synthesized CPF.
Effect of FXR on human SHP/Luc reporter activity
Because bile acids and FXR stimulate SHP mRNA expression in HepG2 cells and FTF regulates SHP transcription, we studied the effect of bile acid, FXR, FTF, and SHP on human SHP/Luc reporter activity. Fig 7a shows that FXR/RXR significantly stimulated SHP/Luc reporter activity by 30%, whereas FTF repressed SHP/Luc reporter activity by 50% in HepG2 cells. FTF had a dominant inhibitory effect over FXR/RXR . SHP alone did not have any effect on SHP reporter activity, but cotransfection with both SHP and FTF strongly repressed SHP reporter activity by 90% (Fig 7a). Thus, the effect of FTF and SHP regulation of SHP transcription is similar to their effects on CYP7A1. CDCA (25 µM) significantly repressed SHP/Luc reporter activity when FTF was cotransfected.
The same experiments were carried out with HEK 293 cells (Fig 7b). FTF strongly stimulated SHP/Luc reporter activity by 5-fold, in contrast to its inhibitory effect in HepG2 cells. SHP alone had no effect, whereas FXR/RXR stimulated SHP reporter activity by 30% and CDCA enhanced the stimulatory effect. SHP strongly repressed SHP reporter activity when cotransfected with FTF. CDCA (25 µM) stimulated SHP reporter activity by 2-fold when cotransfected with FXR. Thus FTF is a repressor of SHP transcription as assayed in HepG2 cells but an activator in 293 cells.
 |
DISCUSSION |
|---|
It is now well recognized that FXR is a highly specific bile acid receptor that is activated by hydrophobic bile acids at physiological concentrations to regulate the genes involved in bile acid synthesis and transport. The positive effect of FXR on its target genes is due to binding of FXR to its unique response elements in these genes. FXR perhaps is the most specific orphan nuclear receptor identified so far. However, the mechanism of negative regulation of CYP7A1 by FXR is less understood. SHP is a nonspecific negative factor that interacts with many nuclear receptors by either competing for coactivators and/or directly repressing their transactivating activity (23). It appears that SHP interacts with FTF and represses CYP7A1 transcription. However, our study revealed, by both an in vivo study in rats and an in vitro study in HepG2 cells, that bile acids also stimulate FTF expression. Interestingly, FTF can serve as a negative factor that may directly repress both CYP7A1 and SHP transcription in the liver. Multiple NR5A2 receptors are expressed in liver by differential transcription and processing of mRNA (9). Human FTF is identical to CPF variant 1 (10) and human CPF is identical to hB1F (10) (11). FTF and CPF differ in their N-terminal sequences (9) (10). It is possible that different amounts of NR5A2 isoforms may be expressed in different species and differentially regulate their target genes. It is also possible that FTF may compete with HNF4 for overlapping binding sites in the BARE-II. HNF4 has been established as an orphan receptor that is important for basal transcription of CYP7A1 (8) (24).
Our results revealed that induction of SHP mRNA expression by bile acids in rat liver and HepG2 cells was much less than that observed in mice (16) (18). SHP expression is regulated mainly by monomeric nuclear receptors, such as FTF and steroidogenic factor 1 (25). The SHP induced by bile acids then feedback represses its own synthesis by interacting with FTF. It is therefore not surprising that bile acids and FXR do not induce SHP expression in rat livers and HepG2 cells. The relative expression levels of FXR, SHP, and FTF ultimately may determine both the CYP7A1 and SHP expression levels in different species under different conditions. SHP functions primarily as a negative regulator that suppresses the activity of many nuclear receptors. Therefore, the level of SHP expression must be tightly regulated in vivo and the expression levels of SHP, HNF4, and FTF may determine the expression of cholesterol 7 -hydroxylase activity in the liver. The induction of SHP in mouse but not rat liver may explain the much lower CYP7A1 activity in mouse than rat livers. Other factors, such as bile acid pool size, composition and hydrophobicity, the efficiency of enterohepatic circulation of bile, and the relative expression levels of nuclear receptors involved in regulation of CYP7A1 transcription, may explain the wide variations in cholesterol 7 -hydroxylase activity and mRNA expression levels in different species.
It has been suggested that SHP and FTF may regulate CYP8B1 expression (16) (17) (18), because rat CYP8B1 also has FTF-binding sites (26). We notice that the FTF-binding sites in the rat and human CYP8B1 promoters also contain overlapping HNF4-binding sites, similar to the bile acid response element of the CYP7A1 promoter. We propose that either FTF or HNF4 is involved in mediating bile acid repression depending on the structure of the bile acid response elements in the genes. Fig 8 illustrates a cascade mechanism for FXR-mediated repression of CYP7A1 transcription by bile acids, developed on the basis of this study. Bile acids bind and activate bile acid receptor, FXR. FXR then induces the expression of bile acid-responsive proteins such as FTF, SHP, and HNF4. When the SHP level increases, it interacts with FTF and represses its own transcription. In this mechanism, FTF could serve as a dominant negative factor that represses both CYP7A1 and SHP transcription. SHP interacts with either FTF or HNF4 and inhibits gene transcription depending on the structure of the genes. It is intriguing as why FXR, a relatively specific bile acid receptor, mediates its inhibitory effect through SHP and FTF, which are relatively nonspecific receptors. It seems that a cascade mechanism involving both bile acid receptor and bile acid-responsive protein not only amplifies the bile acid signals, but also confers the gene-specific and tissue-specific regulation of the genes in bile acid synthesis. How the FTF gene is regulated is not known at present. Identification of the FTF ligands, knockout of the ftf gene in mice, and cloning of the rat and human FTF genes would provide useful tools for studying FTF regulation.
Bile acid feedback regulation of the genes in bile acid synthesis plays an important role in maintaining cholesterol homeostasis. Bile acids may also regulate other genes in intermediate metabolism. The mechanisms of bile acid inhibition of gene transcription are complex and warrant further study to identify other target genes and nuclear receptors regulated by bile acids. These genes are potential targets for drug therapies to reduce serum cholesterol level and prevent cholestasis and cirrhosis.
 |
ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health grants GM31584 and DK44442 to J.Y.L.C.
Manuscript received March 9, 2001; and in revised form May 7, 2001
Abbreviations:
BARE-I and -II, bile acid response elements I and II; CA, cholic acid; CDCA, chenodeoxycholic acid; CYP7A1, cholesterol 7 -hydroxylase gene; CYP8B1, sterol 12 -hydroxylase gene; DCA, deoxycholic acid; DR, direct repeat; EMSA, electrophoretic mobility shift assay; FTF, -fetoprotein transcription factor; FXR, farnesoid X receptor; HEK, human embryonic kidney; HNF4, hepatocyte nuclear factor 4; IBABP, ileum bile acid-binding protein; LXR, liver orphan receptor; Luc, luciferase; NTCP, Na+-taurocholate cotransport protein; RXR, retinoid X receptor; SHP, small heterodimer partner; TCA, taurocholic acid; TCDCA, taurochenodeoxycholic acid; TDCA, taurodeoxycholic acid; TLCA, taurolithocholic acid; TUDCA, tauroursodeoxycholic acid; UDCA, ursodeoxycholic acid
 |
REFERENCES |
|---|
- Chiang, J. Y. L. 1998. Regulation of bile acid synthesis. Front. Biosci. 3:D176-D193.
- Chiang, J. Y. L., Miller, W. F., Lin, G. M. 1990. Regulation of cholesterol 7- hydroxylase in the liver: purification of cholesterol 7-hydroxylase and the immunochemical evidence for the induction of cholesterol 7-hydroxylase by cholestyramine and circadian rhythm. J. Biol. Chem. 265:3889-3897[Abstract/Free Full Text].
- Crestani, M., Karam, W. G., Chiang, J. Y. L. 1994. Effects of bile acids and steroid/thyroid hormones on the expression of cholesterol 7-hydroxylase mRNA and the CYP7 gene in HepG2 cells. Biochem. Biophys. Res. Commun. 198:546-553[Medline].
- Pandak, W. M., Li, Y. C., Chiang, J. Y. L., Studer, E. J., Gurley, E. C., Heuman, D. M., Vlahcevic, Z. R., Hylemon, P. B. 1991. Regulation of cholesterol 7-hydroxylase mRNA and transcriptional activity by taurocholate and cholesterol in the chronic biliary diverted rat. J. Biol. Chem. 266:3416-3421[Abstract/Free Full Text].
- Pandak, W. M., Vlahcevic, Z. R., Heuman, D. M., Redford, K. S., Chiang, J. Y. L., Hylemon, P. B. 1994. Effect of different bile salts on the steady-state mRNA levels and transcriptional activity of cholesterol 7-hydroxylase. Hepatology. 19:941-947[Medline].
- Chiang, J. Y. L., Stroup, D. 1994. Identification and characterization of a putative bile acid responsive element in cholesterol 7-hydroxylase gene promoter. J. Biol. Chem. 269:17502-17507[Abstract/Free Full Text].
- Stroup, D., Crestani, M., Chiang, J. Y. L. 1997. Identification of a bile acid response element in the cholesterol 7
-hydroxylase gene (CYP7A). Am. J. Physiol. 273:G508-G517[Abstract/Free Full Text].
- Crestani, M., Sadeghpour, A., Stroup, D., Gali, G., Chiang, J. Y. L. 1998. Transcriptional activation of the cholesterol 7
-hydroxylase gene (CYP7A) by nuclear hormone receptors. J. Lipid Res. 39:2192-2200[Free Full Text].
- Galarneau, L., Pare, J. F., Allard, D., Hamel, D., Levesque, L., Tugwood, J. D., Green, S., Belanger, L. 1996. The
-fetoprotein locus is activated by a nuclear receptor of the. Drosophila FTZ-F1(family. Mol. Cell. Biol. 16):3853-3865.
- Nitta, M., Ku, S., Brown, C., Okamoto, A. Y., Shan, B. 1999. CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7-hydroxylase gene. Proc. Natl. Acad. Sci. USA. 96:6660-6665[Abstract/Free Full Text].
- Li, M., Xie, Y. H., Kong, Y. Y., Wu, X., Zhu, L., Wang, Y. 1998. Cloning and characterization of a novel human hepatocyte transcription factor, hB1F, which binds and activates enhancer II of hepatitis B virus. J. Biol. Chem. 273:29022-29031[Abstract/Free Full Text].
- Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., Shan, B. 1999. Identification of a nuclear receptor for bile acids. Science. 284:1362-1365[Abstract/Free Full Text].
- Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., Lehmann, J. M. 1999. Bile acids: natural ligands for an orphan nuclear receptor. Science. 284:1365-1368[Abstract/Free Full Text].
- Wang, H., Chen, J., Hollister, K., Sowers, L. C., Forman, B. M. 1999. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol. Cell. 3:543-553[Medline].
- Chiang, J. Y. L., Kimmel, R., Weinberger, C., Stroup, D. 2000. FXR responds to bile acids and represses cholesterol 7
-hydroxylase gene (CYP7A1) transcription. J. Biol. Chem. 275:10918-10924[Abstract/Free Full Text].
- Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J., Mangelsdorf, D. J. 2000. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol. Cell. 6:507-515[Medline].
- Goodwin, B., Jones, S. A., Price, R. R., Watson, M. A., McKee, D. D., Moore, L. B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M. E., Maloney, P. R., Willson, T. M., Kliewer, S. A. 2000. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol. Cell. 6:517-526[Medline].
- Sinal, C. J., Miyata, M., Tohkin, M., Nagata, K., Bend, J. R., Gonzalez, F. J. 2000. Targeted disruption of soluble epoxide hydrolase reveals a role in blood pressure regulation. Cell. 102:731-744[Medline].
- Wang, D. P., Stroup, D., Marrapodi, M., Crestani, M., Galli, G., Chiang, J. Y. L. 1996. Transcriptional regulation of the human cholesterol 7
-hydroxylase gene (CYP7A) in HepG2 cells. J. Lipid Res. 37:1831-1841[Abstract].
- Crestani, M., Stroup, D., Chiang, J. Y. L. 1995. Hormonal regulation of the cholesterol 7
-hydroxylase gene (CYP7). J. Lipid Res. 36:2419-2432[Abstract].
- Taylor, D. G., Haubenwallner, S., Leff, T. 1996. Characterization of a dominant negative mutant form of the HNF-4 orphan receptor. Nucleic Acids Res. 24:2930-2935[Abstract/Free Full Text].
- Andreou, E. R., Prokipcak, R. D. 1998. Analysis of human CYP7A1 mRNA decay in HepG2 cells by reverse transcription-polymerase chain reaction. Arch. Biochem. Biophys. 357:137-146[Medline].
- Lee, Y. K., Dell, H., Dowhan, D. H., Hadzopoulou-Cladaras, M., Moore, D. D. 2000. The orphan nuclear receptor SHP inhibits hepatocyte nuclear factor 4 and retinoid X receptor transactivation: two mechanisms for repression. Mol. Cell. Biol. 20:187-195[Abstract/Free Full Text].
- Cooper, A. D., Chen, J., Botelho-Yetkinler, M. J., Cao, Y., Taniguchi, T., Levy-Wilson, B. 1997. Characterization of hepatic-specific regulatory elements in the promoterregion of the human cholesterol 7
-hydroxylase gene. J. Biol. Chem. 272:3444-3452[Abstract/Free Full Text].
- Lee, Y. K., Parker, K. L., Choi, H. S., Moore, D. D. 1999. Activation of the promoter of the orphan receptor SHP by orphan receptors that bind DNA as monomers. J. Biol. Chem. 274:20869-20873[Abstract/Free Full Text].
- del Castillo-Olivares, A., Gil, G. 2000.
-Fetoprotein transcription factor is required for the expression of sterol 12-hydroxylase, the specific enzyme for cholic acid synthesis. Potential role in the bile acid-mediated regulation of gene transcription. J. Biol. Chem. 275:17793-17799[Abstract/Free Full Text].

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
X. Song, R. Kaimal, B. Yan, and R. Deng
Liver receptor homolog 1 transcriptionally regulates human bile salt export pump expression
J. Lipid Res.,
May 1, 2008;
49(5):
973 - 984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Callaghan, E. Crowley, S. Potter, and I. D. Kerr
P-glycoprotein: So Many Ways to Turn It On
J. Clin. Pharmacol.,
March 1, 2008;
48(3):
365 - 378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Shang, L. Pan, M. Saumoy, J. Y. L. Chiang, G. S. Tint, G. Salen, and G. Xu
An overlapping binding site in the CYP7A1 promoter allows activation of FXR to override the stimulation by LXR{alpha}
Am J Physiol Gastrointest Liver Physiol,
October 1, 2007;
293(4):
G817 - G823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Woods, J. P. Vanden Heuvel, and I. Rusyn
Genomic Profiling in Nuclear Receptor-Mediated Toxicity
Toxicol Pathol,
June 1, 2007;
35(4):
474 - 494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C Thomas, J-F Landrier, D Gaillard, J Grober, M-C Monnot, A Athias, and P Besnard
Cholesterol dependent downregulation of mouse and human apical sodium dependent bile acid transporter (ASBT) gene expression: molecular mechanism and physiological consequences
Gut,
September 1, 2006;
55(9):
1321 - 1331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-H. Song, T. Li, and J. Y. L. Chiang
A Prospero-related Homeodomain Protein Is a Novel Co-regulator of Hepatocyte Nuclear Factor 4{alpha} That Regulates the Cholesterol 7{alpha}-Hydroxylase Gene
J. Biol. Chem.,
April 14, 2006;
281(15):
10081 - 10088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Claudel, B. Staels, and F. Kuipers
The Farnesoid X Receptor: A Molecular Link Between Bile Acid and Lipid and Glucose Metabolism
Arterioscler. Thromb. Vasc. Biol.,
October 1, 2005;
25(10):
2020 - 2030.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Honda, G. Salen, Y. Matsuzaki, A. K. Batta, G. Xu, T. Hirayama, G. S. Tint, M. Doy, and S. Shefer
Disrupted coordinate regulation of farnesoid X receptor target genes in a patient with cerebrotendinous xanthomatosis
J. Lipid Res.,
February 1, 2005;
46(2):
287 - 296.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Balasubramaniyan, M. Shahid, F. J. Suchy, and M. Ananthanarayanan
Multiple mechanisms of ontogenic regulation of nuclear receptors during rat liver development
Am J Physiol Gastrointest Liver Physiol,
February 1, 2005;
288(2):
G251 - G260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Li and J. Y. L. Chiang
Mechanism of rifampicin and pregnane X receptor inhibition of human cholesterol 7{alpha}-hydroxylase gene transcription
Am J Physiol Gastrointest Liver Physiol,
January 1, 2005;
288(1):
G74 - G84.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bhalla, C. Ozalp, S. Fang, L. Xiang, and J. K. Kemper
Ligand-activated Pregnane X Receptor Interferes with HNF-4 Signaling by Targeting a Common Coactivator PGC-1{alpha}: FUNCTIONAL IMPLICATIONS IN HEPATIC CHOLESTEROL AND GLUCOSE METABOLISM
J. Biol. Chem.,
October 22, 2004;
279(43):
45139 - 45147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Dussault, R. Beard, M. Lin, K. Hollister, J. Chen, J.-H. Xiao, R. Chandraratna, and B. M. Forman
Identification of Gene-selective Modulators of the Bile Acid Receptor FXR
J. Biol. Chem.,
February 21, 2003;
278(9):
7027 - 7033.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Xu, L.-x. Pan, H. Li, B. M. Forman, S. K. Erickson, S. Shefer, J. Bollineni, A. K. Batta, J. Christie, T.-h. Wang, et al.
Regulation of the Farnesoid X Receptor (FXR) by Bile Acid Flux in Rabbits
J. Biol. Chem.,
December 20, 2002;
277(52):
50491 - 50496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Y. L. Chiang
Bile Acid Regulation of Gene Expression: Roles of Nuclear Hormone Receptors
Endocr. Rev.,
August 1, 2002;
23(4):
443 - 463.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cui, T. S. Heard, J. Yu, J.-L. Lo, L. Huang, Y. Li, J. M. Schaeffer, and S. D. Wright
The Amino Acid Residues Asparagine 354 and Isoleucine 372 of Human Farnesoid X Receptor Confer the Receptor with High Sensitivity to Chenodeoxycholate
J. Biol. Chem.,
July 12, 2002;
277(29):
25963 - 25969.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Inokuchi, E. Hinoshita, Y. Iwamoto, K. Kohno, M. Kuwano, and T. Uchiumi
Enhanced Expression of the Human Multidrug Resistance Protein 3 by Bile Salt in Human Enterocytes. A TRANSCRIPTIONAL CONTROL OF A PLAUSIBLE BILE ACID TRANSPORTER
J. Biol. Chem.,
December 7, 2001;
276(50):
46822 - 46829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zhang and J. Y. L. Chiang
Transcriptional Regulation of the Human Sterol 12alpha -Hydroxylase Gene (CYP8B1). ROLES OF HEPATOCYTE NUCLEAR FACTOR 4alpha IN MEDIATING BILE ACID REPRESSION
J. Biol. Chem.,
November 2, 2001;
276(45):
41690 - 41699.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
Advertisement
Advertisement
|