HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: M200277-JLR200v1 43/11/1939    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wellington, C. L. Articles by Hayden, M. R. Search for Related Content PubMed PubMed Citation Articles by Wellington, C. L. Articles by Hayden, M. R. Social Bookmarking                      What's this?

Journal of Lipid Research, Vol. 43, 1939-1949, November 2002
Copyright © 2002 by Lipid Research, Inc.

Truncation mutations in ABCA1 suppress normal upregulation of full-length ABCA1 by 9-cis-retinoic acid and 22-R-hydroxycholesterol

Cheryl L. Wellington^*, Yu-Zhou Yang, Stephen Zhou, Susanne M. Clee^*, Bing Tan, Kenichi Hirano^**, Karin Zwarts^*, Anita Kwok^*, Allison Gelfer^*, Michel Marcil, Scott Newman, Kirsten Roomp, Roshni Singaraja^*, Jennifer Collins, Lin-Hua Zhang^*, Albert K. Groen, Kees Hovingh, Alison Brownlie, Sherrie Tafuri, Jacques Genest, Jr., John J. P. Kastelein and Michael R. Hayden^1,*,

^* Centre for Molecular Medicine and Therapeutics, Childrens' and Women's Hospital, University of British Columbia, 980 West 28th Avenue, Vancouver, British Columbia, Canada
Xenon Genetics, Inc., Vancouver, British Columbia, Canada
Pfizer Global Research, Ann Arbor, MI
^** Graduate School of Medicine, Osaka University, Osaka, Japan
Cardiovascular Genetics Laboratory, University Health Centre, Montreal, Quebec, Canada
Academic Medical Centre, Amsterdam, The Netherlands

Published, JLR Papers in Press, August 16, 2002. DOI 10.1194/jlr.M200277-JLR200

¹ To whom correspondence should be addressed. e-mail: mrh{at}cmmt.ubc.ca

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Mutations in ABCA1 uniformly decrease plasma HDL-cholesterol (HDL-C) and reduce cholesterol efflux, yet different mutations in ABCA1 result in different phenotypic effects in heterozygotes. For example, truncation mutations result in significantly lower HDL-C and apoliprotein A-I (apoA-I) levels in heterozygotes compared with nontruncation mutations, suggesting that truncation mutations may negatively affect the wild-type allele. To specifically test this hypothesis, we examined ABCA1 protein expression in response to 9-cis-retinoic acid (9-cis-RA) and 22-R-hydroxycholesterol (22-R-OH-Chol) in a collection of human fibroblasts representing eight different mutations and observed that truncation mutations blunted the response to oxysterol stimulation and dominantly suppressed induction of the remaining full-length allele to 5–10% of wild-type levels. mRNA levels between truncation and nontruncation mutations were comparable, suggesting that ABCA1 expression was suppressed at the protein level. Dominant negative activity of truncated ABCA1 was recapitulated in an in vitro model using transfected Cos-7 cells. Our results suggest that the severe reduction of HDL-C in patients with truncation mutations may be at least partly explained by dominant negative suppression of expression and activity of the remaining full-length ABCA1 allele.

These data suggest that ABCA1 requires a physical association with itself or other molecules for normal function and has important pharmacogenetic implications for individuals with truncation mutations.

Abbreviations: apoA-I, apolipoprotein A-I; apoA-II, apolipoprotein A-II; BMI, body mass index; 9-cis-RA, 9-cis-retinoic acid; FCS, fetal calf serum; FHA, hypoalphalipoproteinemia; GAPDH, glyceraldehyde phosphate dehydrogenase; 22-R-OH-Chol, 22-R-hydroxycholesterol; TD, Tangier Disease

Supplementary key words high density lipoprotein cholesterol • cholesterol efflux • pharmacogenomics

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Mutations in the ABCA1 gene have been identified as the underlying cause of Tangier Disease (TD) and of a dominantly inherited form of hypoalphalipoproteinemia (FHA) associated with reduced cellular cholesterol efflux (1–4). TD is a rare form of HDL cholesterol (HDL-C) deficiency in which patients have mutations in both alleles of ABCA1, resulting in greatly impaired cholesterol efflux and virtually no circulating HDL-C (5). Intracellular cholesterol accumulation in TD patients often results in clinical manifestations of orange tonsils, hepatosplenomegaly, and peripheral neuropathy (5).

Persons heterozygous for ABCA1 mutations have FHA, a less-severe clinical outcome of deficient cholesterol efflux (6). Generally, cells of FHA patients do not have excessive intracellular cholesterol ester accumulation, a feature attributed to the activity of the remaining wild-type allele. Compared with unaffected family members, heterozygotes have HDL-C and apolipoprotein A-I (apoA-I) levels that are reduced by approximately 40% accompanied by a mild decrease in apoA-II and decreased HDL-C particle size (6, 7). In some instances, certain FHA families have cholesterol efflux and HDL-C measurements that are considerably less than 50% of wild-type levels, raising the possibility that the function of the wild-type gene product is negatively affected by particular mutations (6). Understanding the molecular consequences of ABCA1 mutations on protein function will provide crucial information about the relationship between ABCA1 expression and HDL-C, which is a demonstrated protective factor against the development of cardiovascular disease.

To this end, we investigated the effect of eight different ABCA1 mutations on expression of ABCA1 mRNA and protein in primary fibroblasts in individuals from FHA and TD families (6). The mutations investigated in this study are dispersed throughout the ABCA1 gene and were specifically chosen to represent several different types, including missense, small in-frame deletions, frameshift, and nonsense mutations. ABCA1 expression is induced by 9-cis-retinoic acid (9-cis-RA) and 22-R-hydroxycholesterol (22-R-OH-Chol), which signal the presence of excess cholesterol (8–12). Here, we report that the normal upregulation of full-length ABCA1protein in response to 9-cis-RA, 22-R-OH-Chol is dominantly suppressed when one ABCA1 allele is prematurely truncated, resulting in ABCA1 protein levels that are approximately 5–10% of those observed in wild-type cells, despite comparable mRNA levels.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Subjects
Subjects heterozygous for ABCA1 mutations from TD and FHA kindreds have been described (6). One new heterozygous subject is included in this study who is from a new TD kindred ( JP2) and contains the truncation mutation R1851X (13). All subjects have informed consent for participation, and all received ethical approval by the University of British Columbia (6).

Cell culture and transfection
RAW murine macrophages and human fibroblasts were maintained in DMEM (Canadian Life Technologies) with 10% fetal calf serum (FCS), 50 U/ml penicillin-streptomycin, 2 mmol L-glutamine, 1x nonessential amino acids (Canadian Life Technologies), and 10 ng/ml epidermal growth factor (Sigma). ABCA1 expression was stimulated by the replacement of the growth medium with media containing delipidated serum (Sigma) with either ethanol (control) or 10 µmol/l 9-cis RA (10 mg/ml stock in ethanol, Sigma) and 4 µg/ml 22-R-OH-Chol (4 mg/ml stock in ethanol; Steraloids) for up to 24 h. Cos-7 cells were cultured in DMEM with 10% FCS, 50 U/ml penicillin-streptomycin, and 2 mmol/l L-glutamine. One day prior to transfection, cells were seeded at 1.6 x 10⁵/well into 12-well plates coated with type I collagen. The next day, cells at approximately 95% confluence were transfected using Lipofectamine 2000 (Canadian Life Technologies) following the manufacturer's recommendations. Cells were transfected with wild-type or truncated human ABCA1 cDNA expression constructs tagged with the FLAG epitope (DYKDDDDK) at the C terminus to permit verification of expression in transfected cells as described (13).

Protein isolation and Western blotting
Cell pellets were lysed by trituration in 20 mmol/l HEPES, 5 mmol/l KCl, 5 mmol/l MgCl₂, 0.5% (v/v) Triton X-100, and Complete protease inhibitor (Roche Molecular Biochemicals). Cell debris was removed by centrifugation at 5,000 rpm for 4 min at 4°C. The supernatant was collected and stored at -70°C. Protein concentration was determined by a Lowry assay. Equal amounts of protein were separated on 7.5% SDS-PAGE gels and electrophoretically transferred to polyvinylidene difluoride membrane (Millipore) prior to immunodetection with antibodies specific for the C terminus of ABCA1 (14), anti-glyceraldehyde phosphate dehydrogenase (GAPDH, Chemicon) as a loading control, anti-FLAG (Sigma), or anti-Xpress (Invitrogen), according to the manufacturers' recommendations. Immunoreactivity was detected by enhanced chemiluminescence (Amersham). Protein abundance was calculated by densitometry using National Institutes of Health Image 6.0 software and normalized to GAPDH levels. Densitometry was performed on duplicate or triplicate gels run from at least three independent experiments, and a wild-type control was included in each gel.

TD4 SNP analysis and Southern blotting
Genomic sequencing of the ABCA1 locus, including all exons, splice junctions, and promoter region was performed as previously described (1). Southern blot analysis of TD4 genomic DNA was performed as described (1), using DNA restricted with BamHI, Hind III, or EcoRI and detection with either a probe encoding the entire human ABCA1 cDNA or corresponding to the promoter region of ABCA1 from -716 to intron 1.

RNA isolation
Cytoplasmic RNA was extracted by lysing cell pellets in 10 mM Tris-HCl, pH 7.8, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% NP40 followed by centrifugation for 30 s. The supernatant was mixed with an equal volume of 200 mM Tris, pH 7.5, 350 mM NaCl, 2% SDS, 25 mM EDTA, extracted twice with phenol-chloroform, once with chloroform, and precipitated with 1 ml ethanol. Pellets were resuspended in 10 mM Tris-HCl, pH 7.5, 1 mM MgCl₂, 0.1U RNase-free DNaseI (Roche Molecular Biochemicals), incubated for 30 min, phenol extracted, and precipitated with ethanol. Pellets were resuspended in RNase-free water and quantitated by absorbance spectrophotometry.

Northern blotting
Equal amounts (20 µg) of cytoplasmic RNA were electrophoresed through 1% agarose, 2 M formaldehyde gels in MOPS buffer, and then transferred to Hybond N+ membrane (Amersham). Membranes were prehybridized and hybridized in a buffer containing 50% formamide, 10% dextran sulfate (w/v), 0.2% BSA, 0.2% Ficoll, 50 mM Tris HCl, pH 7.5, 0.1% sodium pyrophosphate, 1% SDS, 0.5% polyvinylpyrrolidone, 1M NaCl, and 0.1 mg/ml denatured salmon sperm DNA. Murine ABCA1 was detected using a 605 bp fragment of spanning nt positions 1–605 of the murine ABCA1 sequence (Genbank accession X75926). Probe was randomly labeled with [-³²P]dCTP using Rediprime (Amersham) and incubated with the membrane overnight at 42°C. Membranes were washed sequentially in 2x SSC at 42°C, and 2x SSC, 1% SDS at 60°C prior to exposure of film.

Quantitative PCR
Human ABCA1 primers (forward 5' CCTGACCGGGTTGTTCCC 3' and reverse 5' TTCTGCCGGATGGTGCTC 3' and the TaqMan probe (5'ACATCCTGGGAAAAGACATTCGCTCTGA 3') were designed using Primer Express software (Applied Biosystems, Foster City, CA). RT-PCR reactions were performed on an ABI P_RISM 7700 machine in a final volume of 50 µl, containing 40 ng of total RNA, 200 µM human ABCA1 primers, and 600 µM probe in 1x TaqMan One-Step RT-PCR Master mix (PE Biosystems, CA), according to the manufacturer's instructions. Ribosomal 18s rRNA primers and probe mix (PE Biosystems) were included in the reaction as an internal control. RT reactions were run at 48°C for 30 min and heat inactivated at 95°C for 10 min. PCR reactions were carried out for 30 cycles (denaturation at 95°C for 15 s, annealing and extention at 60°C for 1 min). Data quantification and analysis were performed according to the manufacturer's protocol (PE Biosystems). Values were calculated relative to the level of the control. Each sample was assayed in duplicate in at least two independent experiments.

For semiquantitative analysis of RNA extracted from transfected Cos-7 cells, RT-PCR reactions using murine-specific or human-specific ABCA1 and 18 S ribosomal primers were performed as previously described (14).

Cholesterol efflux
Lipid levels in TD and FHA patients were measured as described and HDL-C was expressed as mmol/l (1, 4). Cellular cholesterol efflux assays on primary human fibroblasts were performed as described (1, 4, 6). Briefly, efflux in the absence or presence of either 20 or 30 µg/ml apoA-I was measured over 24 h and calculated as the percent of free cholesterol in the medium relative to total cholesterol. Each experiment was performed in triplicate, averaged, and expressed as the percentage of efflux relative to the average efflux values obtained from primary fibroblasts of two healthy controls included as standards within the same experiment. Transfected Cos-7 cells were labeled with 1.0 µCi/ml ³H-cholesterol on the day after transfection. After labeling for 18 h, the cells were washed three times with PBS and incubated for 2 h with DMEM plus 0.2% defatted BSA (Sigma). The media was then replaced with fresh DMEM and 0.2% BSA with or without 15 µg/ml apoA-I for 4 h. Radioactivity in the media was counted directly, cells were dissolved with 0.1 N NaOH and counted, and percent efflux was calculated as above. Each experiment was performed at least in triplicate.

Statistical analysis
Demographics, HDL-C, and apoA-I levels in truncation versus nontruncation heterzygotes were compared using a two-tailed Student's t-test. Analysis of the proportion of individuals within given HDL-C percentile ranges was performed by ² analysis. Comparisons of ABCA1 mRNA and protein expression were performed using two-tailed unpaired Student's t-tests or, where applicable, one-way ANOVA with a Neuman-Keuls posttest. All statistical analyses were performed using Prism (version 3.0; Graphpad Software for Science Inc., San Diego, CA) or Systat (version 8.0, SPSS Inc, Chicago, IL).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
HDL-C and apoA-I levels are significantly reduced in heterozygous carriers of mutations resulting in truncated compared with nontruncated ABCA1 alleles
We previously examined the phenotypes of 77 heterozygous individuals from 11 FHA and TD families that represent 13 different ABCA1 mutations and identified an approximately 40–50% decrease in HDL-C and apoA-I in heterozygotes compared with unaffected family members (6). In the present analysis, we excluded two individuals presumed to be heterozygous based on phenotype and cosegregation analyses because no mutation within the ABCA1 open reading frame has yet been identified. We also obtained one additional confirmed heterozygous individual ( JP2) (13). The cohort analyzed in this study therefore consisted of 76 confirmed heterozygous individuals.

To determine the significance of mutation type on HDL-C and apoA-I levels, heterozygous individuals from these families were divided into two groups. One group consisted of all individuals with any mutation predicted to result in premature truncation of ABCA1, including nonsense, frameshift, and splice-site mutations. The other group consisted of individuals with missense or small in-frame deletions that would result in maintenance of a full-length allele and specific preservation of the C-terminal end of ABCA1. This division differed from a previous analysis (6) by separating the groups on the basis of predicted protein length (truncation vs. nontruncation) rather than on that of presumed severity (missense vs. truncation as well as in-frame deletions).

Comparison of the overall demographics between the truncation and nontruncation groups showed no differences in age, body mass index (BMI), or gender distributions (Fig. 1A) . In contrast, apoA-I and HDL-C levels were significantly reduced in heterozygotes for truncation mutations compared with nontruncation mutations (P = 0.03 and 0.04, respectively) (Fig. 1B). Comparison of the distribution of HDL-C levels between the groups showed that HDL-C levels are shifted toward lower levels in truncation compared with nontruncation heterozygotes (Fig. 1C, D). Significantly, not a single heterozygote for a truncation mutation had an HDL-C level greater than 1.0 mmol/l, whereas these levels were observed in approximately 20% of nontruncation mutation heterozygotes (P = 0.01) (Fig. 1C). Finally, significantly more truncation heterozygotes had HDL-C levels below the 5th percentile for age and sex than nontruncation heterozygotes (Fig. 1D, P = 0.02). These results provide the first indication that the type of mutation in ABCA1 has a significant effect on HDL-C levels in vivo and that truncation mutations depress HDL-C levels significantly more than nontruncation mutations.

View larger version (33K): [in this window] [in a new window]   Fig. 1. Effect of ABCA1 mutation type on HDL cholesterol (HDL-C) and apolipoprotein A-I (apoA-I) levels in a cohort of 76 confirmed heterozygous individuals from 12 different hypoalphalipoproteinemia (FHA) and Tangier Disease (TD) families representing truncation (white bar) and nontruncation (black bar) heterozygotes. A: Age, body mass index (BMI), and sex are not significantly different between heterozygous carriers of truncation compared with nontruncation mutations. The truncation group contained 26 individuals, for whom BMI (kg/m2) data were available for 20 persons. Ten of 26 persons were male in the truncation group. Similarly, the nontruncation group consisted of 50 individuals for whom BMI data were present for 40 persons, and 22/50 individuals were male. Comparison was done by Student's t-test. B: HDL-C (mmol/l) and apoA-I (g/l) levels are reduced in heterozygotes of truncation compared with nontruncation mutations. The HDL-C and apoA-I values from heterozygotes for truncation or nontruncation ABCA1 mutations were averaged and compared using a Student's t-test. C and D: HDL-C distributions by absolute level (C) and by age- and sex-normalized percentile (D) analyzed by 2 analysis.

View larger version (39K): [in this window] [in a new window]   Fig. 2. Dynamics of ABCA1 expression in primary human fibroblasts and RAW murine macrophages in response to 9-cis-retinoic acid (9-cis-RA), 22-R-hydroxycholesterol (22-R-OH-Chol) stimulation. A: Northern blot showing induction of ABCA1 mRNA from 4 to16 h after stimulation. B: Western blot showing stimulated normal human fibroblasts contain abundant ABCA1 protein from 8 to 24 h after stimulation. C: Densitometric quantitation of expression dynamics in human fibroblasts. ABCA1 mRNA levels were expressed relative to rRNA levels, and ABCA1 protein levels were normalized to glyceraldehyde phosphate dehydrogenase (GAPDH) expression. Data are representative of two independent experiments. D: Densitometric quantitation of induction kinetics of murine ABCA1 mRNA and protein showing maximal mRNA expression at 4 h and maximal protein expression 8 h after stimulation.

View larger version (38K): [in this window] [in a new window]   Fig. 3. ABCA1 protein expression in response to 9-cis-RA, 22-R-OH-Chol stimulation. A: RAW murine macrophages, wild-type human primary fibroblasts, and primary fibroblasts from eight TD or FHA families were harvested after a 16 h exposure to delipidated serum growth media without (-) and with (+) 10 µM each of 9-cis-RA, 22-R-OH-Chol. ABCA1 protein is markedly reduced in stimulated cells with truncation mutations compared with nontruncation mutations. Equivalent results were obtained using two different verified ABCA1 antibodies. B: Densitometric quantitation of ABCA1-GAPDH protein upregulation in stimulated fibroblasts, demonstrating reduced ABCA1 levels in stimulated fibroblasts with truncation mutations compared with nontruncation mutations. Values represent the mean of 3 to 5 independent experiments for each fibroblast cell type. Three different wild-type fibroblasts, each assayed in triplicate, were pooled to give an overall induction in wild-type fibroblasts. Statistical comparison is by one-way ANOVA with a Neuman-Kuels posttest. C: Western blot of ABCA1 protein in wild-type, TD1, and TD3 compound heterozygote, and TD1-h and TD3-h heterozygous fibroblasts stimulated as above. D: Densitometric quantitation of triplicate experiments from C, in which one wild-type fibroblast was used as a control. Data from the quantitations in B and D were pooled to give the values represented in Table 1. E: Cholesterol efflux activity over 24 h in wild-type, TD1, and TD3 compound heterozygote, and TD1-h and TD3-h heterozygous fibroblasts. Data represent the mean of triplicate measurements performed side by side with two wild-type controls (pooled) in the absence (-) or presence (+) of 20 µg/ml apoA-I.

As a negative control, we included TD4 fibroblasts, which are homozygous for a deletion of C6825 that would result in truncation of both ABCA1 gene products. Homozygosity in TD4 cells is supported by complete sequencing of the ABCA1 gene, a cSNP analysis that demonstrated homozygosity across the ABCA1 gene except at the extreme 5' end, and Southern blot analysis demonstrating equivalent bands detected in both TD4 and wild-type control lanes (data not shown). Even in stimulated TD4 fibroblasts, ABCA1 protein is undetectable by either C-terminal antibody, which confirms the specificity of these antibodies to ABCA1 without detectable cross-reactivity to other ABC transporters.

Suppression of ABCA1 protein induction by 9-cis-RA, 22-R-OH-Chol occurs at the protein level in fibroblasts containing one truncated allele
The failure to observe upregulation of wild-type ABCA1 protein by 9-cis-RA, 22-R-OH-Chol in fibroblasts containing one truncated allele could occur at the mRNA or protein levels. To distinguish between these possibilities, cytoplasmic RNA was collected from fibroblasts before and after an 8 h treatment with 9-cis-RA, 22-R-OH-Chol and quantitatively analyzed for ABCA1 expression using real-time RT-PCR analysis using the Light Cycler (Roche). The 8 h time point was selected because it coincided with the midpoint of mRNA expression as determined by Northern blot analysis of wild-type fibroblasts. Real-time PCR quantitation showed that ABCA1 mRNA was present in each fibroblast type 8 h after stimulation (Fig. 4A) . Although there are differences in the level of ABCA1 mRNA detected among fibroblasts from different genetic backgrounds, there were no significant differences between the truncation compared with nontruncation samples (N = 5–8, P > 0.05), confirming that ABCA1 mRNA is upregulated in response to 9-cis-RA, 22-R-OH-Chol in all cell types. Additionally, we determined the ratio of fold induction of ABCA1 protein relative to the fold induction of ABCA1 mRNA (Fig. 4B). Furthermore, wild-type cells and the nontruncation mutations were found to generate similar levels of ABCA1 protein per mRNA (Fig. 4B, P > 0.05), whereas all of the fibroblasts containing truncation mutations were impaired in their ability to generate ABCA1 protein (Fig. 4B, P < 0.0001). Additionally, the induction of ABCA1 mRNA is not significantly different between truncation and nontruncation fibroblasts (P > 0.05). Therefore, the failure to observe ABCA1 protein upregulation in cells containing truncation mutations is most likely due either to decreased translational efficiency of the full-length allele or increased turnover of the full-length protein in the presence of the truncated protein product.

View larger version (38K): [in this window] [in a new window]   Fig. 4. ABCA1 mRNA expression in response to 9-cis-RA, 22-R-OH-Chol stimulation in human fibroblasts. Cytoplasmic RNA was collected from unstimulated cells as well as cells stimulated for 8 h and subjected to quantitative determination of ABCA1 mRNA using the Light-Cycler. A: Data from two independent experiments, each performed in triplicate, are pooled. Levels of ABCA1 mRNA in stimulated cells vary among individual fibroblasts, but are not consistently lower in truncation versus nontruncation samples. Statistical comparison is by one-way ANOVA with a Neuman-Keuls posttest. B: Relative protein per RNA was calculated by determining the ratio of fold induction of ABCA1 protein (normalized to GAPDH) relative to fold induction of ABCA1 mRNA (normalized to 18s rRNA) in stimulated compared with unstimulated fibroblasts. Values represent means from two independent experiments, with each measurement performed in triplicate. Statistical comparison is by one-way ANOVA with a Neuman-Keuls posttest.

Cells transfected with Xpress-tagged wild-type ABCA1 alone expressed ABCA1 protein and exhibited apoA-I-dependent cholesterol efflux compared with vector only (mock) transfected cells (P < 0.001, n = 3, Fig. 5A, B) . Cotransfection of FLAG-tagged wild-type and Xpress-tagged wild-type ABCA1 resulted in a doubling of efflux activity (P < 0.001, n = 3), and Western blotting showed that wild-type ABCA1 protein was expressed from both constructs (Fig. 5A, B). It should be noted that because the Xpress and FLAG antibodies have different affinities, Western blotting cannot be used to estimate the relative levels of ABCA1 expressed from either tagged construct.

View larger version (42K): [in this window] [in a new window]   Fig. 5. Dominant negative suppression of ABCA1 activity in transfected cells. Cos-7 cells were transfected singly with vector (mock), Xpress-tagged wild-type human ABCA1 cDNA (WT/Xpress), or cotransfected with FLAG-tagged wild-type ABCA1 (WT/Xpress + WT/FLAG), FLAG-tagged ABCA1 containing the N1611D mutation (WT/Xpress + N1611D/FLAG), or with FLAG-tagged ABCA1 containing the R1851X mutation (WT/Xpress + R1851X/FLAG). A: Western blot analysis of vector or ABCA1-transfected cells using the Xpress or FLAG antibodies. The positions of full-length or truncated ABCA1 are marked. B: ApoA-I-dependent cholesterol efflux activity in vector or ABCA1-transfected cells. Efflux is expressed as the percent of counts in the medium relative to total counts in cells plus medium. Data are representative of three independent experiments. Statistical comparison is by one-way ANOVA with a Neuman-Kuels posttest. C: Semiquantitative RT-PCR using human-specific ABCA1 primers as well as 18s rRNA primers as an internal control. RNA was prepared from untransfected Cos-7 cells or cells singly transfected with FLAG-tagged ABCA1 constructs.

To rule out the possibility that differences in mRNA expression between the FLAG-tagged wild-type, truncation, and missense constructs were responsible for the observed differences in protein level and efflux activity, semiquantitative RT-PCR analysis was performed on transfected cells. The results show that each of the FLAG-tagged constructs is similarly expressed in transfected cells (Fig. 5C), confirming that the dominant negative inhibition of ABCA1 protein levels and efflux activity occurs at a posttranscriptional level.

ABCA1 protein levels predict HDL-C levels
The clinical spectrum of TD and FHA patients results from defective ABCA1-mediated efflux of cholesterol and/or phospholipid, which in turn is a function of ABCA1 level and catalytic activity. Increasing ABCA1 protein levels in mice has recently been shown to increase HDL-C levels in vivo in two of three animal models (16–18). Because the sample size of fibroblasts is small, it is difficult to draw strong conclusions about the effect of ABCA1 protein level and HDL-C levels in vivo. Nevertheless, we did observe that protein induction and HDL-C correlated strongly (Fig. 6A , r ² = 0.67, P = 0.002), suggesting that the degree of ABCA1 protein expression in primary fibroblasts predicted HDL-C levels in vivo. ABCA1 protein levels and cholesterol efflux activity in fibroblasts was also correlated and nearly reached statistical significance (Fig. 6B, r ² = 0.33, P = 0.06). Strikingly, for both correlations, all of the fibroblasts expressing ABCA1 with truncation mutations clustered near the bottom of the curve, whereas all of the fibroblasts expressing nontruncation ABCA1 mutations clustered at an intermediate position between wild-type and truncation mutation cells.

View larger version (22K): [in this window] [in a new window]   Fig. 6. ABCA1 protein levels correlate with plasma HDL-C levels and efflux activity. A: The fold increase in ABCA1-GAPDH levels observed upon stimulation of primary fibroblasts with 9-cis-RA, 22-R-OH-Chol (x axis) are plotted against the HDL-C levels from the patient from whom the fibroblasts were obtained (y axis), showing a strong, significant positive correlation (r 2 = 0.68, P = 0.002). Black square, wild-type; gray circle, nontruncation mutation; open triangle, truncation mutation. B: The fold increase in ABCA1:GAPDH levels (x axis) are plotted against the cholesterol efflux activity from the patient from whom the fibroblasts were obtained (y axis), showing a positive correlation that nearly reaches statistical significance (r 2 = 0.33, P = 0.06).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

We now provide a molecular mechanism that may help to explain the clinical variation of individual phenotypes in FHA and TD kindreds through the analysis of ABCA1 expression in primary human fibroblasts representative of a variety of mutation types located throughout the ABCA1 protein coding region. We observed a profound effect of mutation type on the ability of ABCA1 protein to be upregulated in response to oxysterol stimulation. Premature truncations of ABCA1 were found to dominantly inhibit expression of the remaining full-length allele, regardless of whether the full-length allele was wild type or whether it contained a second, nontruncation mutation. In contrast, mutations that maintained ABCA1 translation to its natural C terminus resulted in protein levels that were approximately 70% of those observed in wild-type cells. Furthermore, suppression of ABCA1 expression by truncation mutations occurred at the protein level because ABCA1 mRNA levels are comparable in these fibroblasts. Therefore, a reduction in the steady-state level of ABCA1 protein must be due either to decreased translation or to increased degradation of ABCA1 protein. These findings may explain why FHA or TD heterozygotes for truncation mutations are doubly disadvantaged; not only is one allele nonfunctional by virtue of a severe mutation, but in addition, expression of the remaining wild-type allele is also compromised.

Furthermore, our results suggest that ABCA1 protein levels strongly predict HDL-C and cholesterol efflux. Importantly, we observed that truncation and nontruncation mutations formed nonoverlapping clusters in correlation analyses between ABCA1 protein levels and either HDL-C or cholesterol efflux. For both correlations, all of the truncation mutations clustered near the bottom of these curves, consistent with dominant negative suppression of ABCA1 expression and activity by truncation mutations. These results confirm that truncation mutations are the most severe with respect to their effects on HDL-C levels, cholesterol efflux, and ABCA1 protein levels. In contrast, all of the nontruncation mutations clustered in an intermediate region of the curve, suggesting that nontruncation mutations do not generally have a dominant negative effect on expression of function of the remaining ABCA1 allele.

The dominant negative effect of ABCA1 truncation mutations was also confirmed in a synthetic in vitro system using Cos-7 cells transfected with tagged cDNA expression constructs encoding wild-type or truncated ABCA1. Coexpression of wild-type ABCA1 with ABCA1 containing a missense mutation did not inhibit expression or efflux activity of wild-type ABCA1. By contrast, coexpression of wild-type with truncated ABCA1 decreased cholesterol efflux from wild-type ABCA1 by approximately 65%, demonstrating that ABCA1 fragments dominantly interfere with ABCA1 functional activity.

Dominant negative effects are classically defined in terms of function and can manifest in several ways. Some dominant negative mutations inactivate catalytic activity while maintaining the ability to bind substrate (20–22). Other common dominant negative mutations include truncated molecules that maintain ligand- or target-binding functions but lack other functional domains (23–26). Dominant negative mutations work by inhibiting the function of the wild-type allele, which often occurs by the mutated allele "poisoning" a molecular complex or titrating key components required for function. For example, many fibrillin-1 gene mutations generate fibrillin monomers that impair the global function of microfibrils and result in microfibrillopathies, including Marfan syndrome (27). Additionally, a truncation mutation in endoglin results in a protein fragment that dimerizes with wild-type endoglin protein and dominantly impairs its trafficking to the cell surface (28). Similarly, truncated V2 vasopressin receptors act as dominant negative regulators of wild-type V2 receptor function by inhibiting function and cell surface trafficking of full-length V2 receptors (29).

The finding that truncation mutations in ABCA1 can dominantly suppress protein expression of full-length ABCA1 suggests that association of ABCA1 molecules with other proteins may be required for maintenance of normal ABCA1 protein levels in cells. It is possible that ABCA1 may form higher order complexes that may be critical for its stable accumulation or expression at the cell surface. ABCA1 is a full-size ATP-binding cassette transporter and as such contains all domains required for transporter function in a single molecule (30). Quarter-sized and half-size transporters necessarily form functional complexes for activity (31–34). What is less clear is whether full-sized ATP-binding cassette transporters also have the ability to form functional dimers or other higher order complexes. Our results suggest that higher order complexes may be necessary for maintenance of protein abundance and functional activity at the cell surface because coexpression of one truncated allele is sufficient to significantly reduce overall protein levels and diminish efflux activity.

Much current research aims to identify compounds that increase ABCA1 levels in cells. However, if these compounds act to increase ABCA1 expression through transcriptional mechanisms, we would predict that they would be less effective in patients with truncation mutations, because expression of ABCA1 would remain impaired by the effect of the truncation mutation on ABCA1 translation or protein stability. Conversely, compounds that act at posttranscriptional levels to enhance ABCA1 expression or that enhance ABCA1 activity, perhaps through modulating the interactions of ABCA1 with its protein partners, may be more desirable as potential therapeutics for these patients.

	ACKNOWLEDGMENTS

 
The authors thank Joan Keiser, Ming Wang, Omar Francone, Mark Gray-Keller, Alan Attie, Shizuya Yamashita, Yuji Matsuzawa, and members of our respective groups for their generous contributions. This work is supported by the Canadian Institutes of Health Research (S.M.C., J.G., and M.R.H.), the Heart and Stroke Foundation of Canada (M.R.H.), the Canadian Networks of Centres of Excellence (NCE Genetics, M.R.H.), and Xenon Genetics Inc. (Y-Z.Y., S.Z., S.N., K.R., J.C., A.B., M.R.H.). K.Z. is supported by a grant from the Netherlands Heart Foundation. J.G. is supported by a Chercheur National salary award from the Fonds de la recherche en sante de Quebec. J.J.P.K. is an Established Investigator of the Dutch Heart Foundation. M.R.H. is a holder of a Canada Research Chair.

Manuscript received July 18, 2002 and in revised form July 31, 2002.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

1. Brooks-Wilson, A., M. Marcil, S. M. Clee, L. Zhang, K. Roomp, M. van Dam, L. Yu, C. Brewer, J. A. Collins, H. O. F. Molhuizen, O. Loubser, B. F. F. Ouellette, K. Fichter, K. J. D. Ashbourne Excoffon, C. W. Sensen, S. Scherer, S. Mott, M. Denis, D. Martindale, J. Frohlich, K. Morgan, B. Koop, S. N. Pimstone, J. J. P. Kastelein, J. Genest, Jr., and M. R. Hayden. 1999. Mutations in ABCA1 in Tan-gier disease and familial high-density lipoprotein deficiency. Nat. Genet. 22: 336–345.[CrossRef][Medline]

2. Bodzioch, M., E. Orsó, J. Klucken, T. Langmann, A. Böttcher, W. Diederich, W. Drobnik, S. Barlage, C. Büchler, M. Porsch-Özcürümez, W. E. Kaminski, H. W. Hahmann, K. Oette, G. Rothe, C. Aslanidis, K. J. Lackner, and G. Schmitz. 1999. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier Disease. Nat. Genet. 22: 347–351.[CrossRef][Medline]

3. Rust, S., M. Rosier, H. Funke, Z. Amoura, J-C. Piette, J-F. Deleuze, H. B. Brewer, Jr., N. Duverger, P. Denèfle, and G. Assmann. 1999. Tangier Disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat. Genet. 22: 352–355.[CrossRef][Medline]

4. Marcil, M., A. Brooks-Wilson, S. M. Clee, K. Roomp, L. Zhang, L. Yu, J. A. Collins, M. van Dam, H. O. F. Molhuizen, O. Loubser, B. F. F. Ouellette, C. W. Sensen, K. Fichter, S. Mott, M. Denis, B. Boucher, S. Pimstone, J. Genest, Jr., J. J. P. Kastelein, and M. R. Hayden. 1999. Mutations in the ABCA1 gene in familial HDL deficiency with defective cholesterol efflux. Lancet. 354: 1341–1346.[CrossRef][Medline]

5. Fredrickson, D. S., P. H. Altrocchi, L. V. Avioli, D. W. S. Goodman, and H. C. Goodman. 1961. Tangier Disease. Ann. Intern. Med. 55: 1016–1031.

6. Clee, S. M., J. J. P. Kastelein, M. van Dam, M. Marcil, K. Roomp, K. Y. Zwarts, J. A. Collins, R. Roelants, N. Tamasawa, T. Stulc, T. Suda, R. Ceska, B. Boucher, C. Rondeau, C. DeSouich, A. Brooks-Wilson, H. O. F. Molhuizen, J. Frohlich, J. Genest, Jr., and M. R. Hayden. 2000. HDL cholesterol levels and coronary artery disease in heterozygotes for ABCA1 mutations are predicted by cholesterol efflux levels and influenced by age. J. Clin. Invest. 106: 1263–1270.[Medline]

7. Brousseau, M. E., G. P. Eberhart, J. Dupuis, B. F. Asztalos, A. L. Goldkamp, E. J. Schaefer, and M. W. Freeman. 2000. Cellular cholesterol efflux in heterozygotes for Tangier disease is markedly reduced and correlates with high density lipoprotein cholesterol concentration and particle size. J. Lipid Res. 41: 1125–1135.[Abstract/Free Full Text]

8. Repa, J. J., S. D. Turley, J. A. Lobaccaro, J. Medina, L. Li, K. Lustig, B. Shan, R. A. Heyman, J. M. Dietschy, and D. J. Mangelsdorf. 2000. Regulation of absorption and ABCA1-mediated efflux of cholesterol by RXR heterodimers. Science. 289: 1524–1529.[Abstract/Free Full Text]

9. Schwartz, K., R. M. Lawn, and D. P. Wade. 2000. ABCA1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem. Biophys. Res. Commun. 274: 794–802.[CrossRef][Medline]

10. Costet, P., Y. Luo, N. Wang, and A. R. Tall. 2000. Sterol-dependent transactivation of the ABCA1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275: 28240–28245.[Abstract/Free Full Text]

11. Wang, N., D. L. Silver, P. Costet, and A. R. Tall. 2000. Specific binding of ApoA-I, enhanced cholesterol efflux, and altered plasma membrane morphology in cells expressing ABCA1. J. Biol. Chem. 275: 33053–33058.[Abstract/Free Full Text]

12. Pullinger, C. R., H. Hakamata, P. N. Duchateau, C. Eng, B. E. Aouizerat, M. H. Cho, C. J. Fielding, and J. P. Kane. 2000. Analysis of hABCA1 gene 5' end: additional peptide sequence, promoter region, and four polymorphisms. Biochem. Biophys. Res. Commun. 271: 451–455.[CrossRef][Medline]

13. Nishida, Y., K. Hirano, K. Tsukamoto, M. Nagano, C. Ikegami, K. Roomp, M. Ishihara, N. Sakane, Z. Zhang, K. Tsujii, A. Matsuyama, T. Ohama, F. Matsuura, M. Ishigami, N. Sakai, H. Hiraoka, H. Hattori, C. Wellington, Y. Yoshida, S. Misugi, M. R. Hayden, T. Egashira, S. Yamashita, and Y. Matsuzawa. 2002. Expression and functional analyses of novel mutations of ATP-binding cassette transporter-1 in Japanse patients with high-density lipoprotein deficiency. Biochem. Biophys. Res. Commun. 290: 713–721.[CrossRef][Medline]

14. Wellington, C. L., E. K. Walker, A. Suarez, A. Kwok, N. Bissada, R. Singaraja, Y-Z. Yang, L. H. Zhang, E. James, J. E. Wilson, O. Francone, B. M. McManus, and M. R. Hayden. 2002. ABCA1 mRNA and protein distribution patterns predict multiple different roles and levels of regulation. Lab. Invest. 82: 273–283.[CrossRef][Medline]

15. Bortnick, A. E., G. H. Rothblat, G. Stoudt, K. L. Hoppe, L. J. Royer, J. McNeish, and O. L. Francone. 2000. The correlation of ATP-binding cassette 1 mRNA levels with cholesterol efflux from various cell lines. J. Biol. Chem. 275: 28634–28640.[Abstract/Free Full Text]

16. Singaraja, R. R., V. Bocher, E. R. James, S. M. Clee, L-H. Zhang, B. R. Leavitt, B. Tan, A. Brooks-Wilson, A. Kwok, N. Bissada, Y-Z. Yang, G. Liu, S. R. Tafuri, C. Fievet, C. L. Wellington, B. Staels, and M. R. Hayden. 2001. Human ABCA1 BAC transgenic mice show increased HDL-C and ApoA-I-dependent efflux stimulated by an internal promoter containing LXREs in intron 1. J. Biol. Chem. 276: 33969–33979.[Abstract/Free Full Text]

17. Vaisman, B. L., G. Lambert, M. Amar, C. Joyce, T. Ito, R. D. Shamburek, W. J. Cain, J. Fruchart-Najib, E. D. Neufeld, A. T. Remaley, H. B. Brewer, Jr., and S. Santamarinao-Fojo. 2001. ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice. J. Clin. Invest. 108: 303–309.[CrossRef][Medline]

18. Cavelier, L. B., Y. Qiu, J. K. Bielicki, V. Afzal, J-F. Cheng, and E. M. Rubin. 2001. Regulation and activity of the human ABCA1 gene in transgenic mice. J. Biol. Chem. 276: 18046–18051.[Abstract/Free Full Text]

19. Singaraja, R., C. Fievet, G. Castro, E. R. Jamers, N. Hennuyer, S. M. Clee, N. Bissada, J. C. Choy, J-C. Fruchart, B. M. McManus, and M. R. Hayden. 2002. Increased ABCA1 activity protects against atherosclerosis. J. Clin. Invest. 110: 35–42.[CrossRef][Medline]

20. Zhu, K., B. Debreceni, R. Li, and Y. Zheng. 2000. Identification of Rho GTPase-dependent sites in the Dbl homology domain of oncogenic Dbl that are required for transformation. J. Biol. Chem. 275: 25993–26001.[Abstract/Free Full Text]

21. Mukherjee, S., J. E. Casanova, and M. Hunzicker-Dunn. 2001. Desensitization of the luteinizing hormone/choriogonadotropin receptor in ovarian follicular membranes is inhibited by catalytically inactive ARNO. J. Biol. Chem. 276: 6524–6528.[Abstract/Free Full Text]

22. Pitson, S. M., P. A. B. Moretti, J. R. Zebol, P. Xia, J. R. Gamble, M. A. Vadas, R. J. D'Andrea, and B. W. Wattenberg. 2000. Expression of a catalytically inactive sphingosine kinase mutant blocks agonist-induced sphingosine kinase activation. A dominant-negative sphingosine kinase. J. Biol. Chem. 275: 33945–33950.[Abstract/Free Full Text]

23. Love, J. D., J. T. Gooch, L. Nagy, V. K. Chatterjee, and J. W. Schwabe. 2000. Transcriptional repression by nuclear receptors: mechanisms and roles in disease. Biochem. Soc. Trans. 28: 390–396.[Medline]

24. Williams, D. A., W. Tao, F. Yang, C. Kim, Y. Gu, P. Mansfield, J. E. Levine, B. Petryniak, C. W. Derrow, C. Harris, B. Jia, Y. Zheng, D. R. Ambruso, J. B. Lowe, S. J. Atkinson, M. C. Dinauer, and L. Boxer. 2000. Dominant negative mutation of the hematopoietic-specific Rho GTPase, Rac2, is associated with a human phagocyte immunodeficiency. Blood. 96: 1646–1654.[Abstract/Free Full Text]

25. Gosslar, U., R. Shmid, and B. Holzmann. 1999. Regulation of EGR-1-dependent gene expression by the C-terminal activation domain. Biochem. Biophys. Res. Commun. 255: 208–215.[Medline]

26. Singh, S., H. Tang, J-Y. Lee, and G. Saunders. 1998. Truncation mutations in the transactivation region of PAX6 result in dominant-negative mutants. J. Biol. Chem. 273: 21531–21541.[Abstract/Free Full Text]

27. Robinson, P. N., and M. Godfrey. 2000. The molecular genetics of Marfan syndrome and related microfibrillopathies. J. Med. Genet. 37: 9–25.[Abstract/Free Full Text]

28. Lux, A., C. Gallione, and D. Marchuck. 2000. Expression analysis of endoglin missense and truncation mutations: insights into protein structure and disease mechanisms. Hum. Mol. Genet. 9: 745–755.[Abstract/Free Full Text]

29. Zhu, X., and J. Wess. 1998. Truncated V2 vasopressin receptors as negative regulators of wild-type V2 receptor function. Biochemistry. 37: 15773–15784.[CrossRef][Medline]

30. Klein, I., B. Sarkadi, and A. Váradi. 1999. An inventory of the human ABC proteins. Biochim. Biophys. Acta. 1461: 237–262.[Medline]

31. van Veen, H. W., and W. N. Konings. 1998. The ABC family of multidrug transporters in microorganisms. Biochim. Biophys. Acta. 1365: 31–36.[Medline]

32. Braibant, M., P. Gilot, and J. Content. 2000. The ATP binding cassette (ABC) transport systems of mycobacterium tuberculosis. FEMS Microbiol. Rev. 24: 449–467.[CrossRef][Medline]

33. Saier, M. H., Jr. 2000. Families of transmembrane transporters selective for amino acids and their derivatives. Microbiology. 146: 1775–1795.[Free Full Text]

34. Jetté, L., M. Potier, and R. Béliveau. 1997. P-Glycoprotein is a dimer in the kidney and brain capillary membranes: effect of cyclosporin A and SDZ-PSC 833. Biochemistry. 36: 13929–13937.[CrossRef][Medline]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. L. E. MacDonald, R. R. Singaraja, N. Bissada, P. Ruddle, R. Watts, J. M. Karasinska, W. T. Gibson, C. Fievet, J. E. Vance, B. Staels, et al. Absence of stearoyl-CoA desaturase-1 ameliorates features of the metabolic syndrome in LDLR-deficient mice J. Lipid Res., January 1, 2008; 49(1): 217 - 229. [Abstract] [Full Text] [PDF]

				G. H. Tansley, B. L. Burgess, M. T. Bryan, Y. Su, V. Hirsch-Reinshagen, J. Pearce, J. Y. Chan, A. Wilkinson, J. Evans, K. E. Naus, et al. The cholesterol transporter ABCG1 modulates the subcellular distribution and proteolytic processing of {beta}-amyloid precursor protein J. Lipid Res., May 1, 2007; 48(5): 1022 - 1034. [Abstract] [Full Text] [PDF]

				R. R. Singaraja, H. Visscher, E. R. James, A. Chroni, J. M. Coutinho, L. R. Brunham, M. H. Kang, V. I. Zannis, G. Chimini, and M. R. Hayden Specific Mutations in ABCA1 Have Discrete Effects on ABCA1 Function and Lipid Phenotypes Both In Vivo and In Vitro Circ. Res., August 18, 2006; 99(4): 389 - 397. [Abstract] [Full Text] [PDF]

				V. Hirsch-Reinshagen, S. Zhou, B. L. Burgess, L. Bernier, S. A. McIsaac, J. Y. Chan, G. H. Tansley, J. S. Cohn, M. R. Hayden, and C. L. Wellington Deficiency of ABCA1 Impairs Apolipoprotein E Metabolism in Brain J. Biol. Chem., September 24, 2004; 279(39): 41197 - 41207. [Abstract] [Full Text] [PDF]

				D. M. Selva, V. Hirsch-Reinshagen, B. Burgess, S. Zhou, J. Chan, S. McIsaac, M. R. Hayden, G. L. Hammond, A. W. Vogl, and C. L. Wellington The ATP-binding cassette transporter 1 mediates lipid efflux from Sertoli cells and influences male fertility J. Lipid Res., June 1, 2004; 45(6): 1040 - 1050. [Abstract] [Full Text] [PDF]

				L. Krimbou, M. Denis, B. Haidar, M. Carrier, M. Marcil, and J. Genest Jr. Molecular interactions between apoE and ABCA1: impact on apoE lipidation J. Lipid Res., May 1, 2004; 45(5): 839 - 848. [Abstract] [Full Text] [PDF]

				C. L. Wellington, L. R. Brunham, S. Zhou, R. R. Singaraja, H. Visscher, A. Gelfer, C. Ross, E. James, G. Liu, M. T. Huber, et al. Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human ABCA1 J. Lipid Res., August 1, 2003; 44(8): 1470 - 1480. [Abstract] [Full Text] [PDF]