Advertisement
J. Lipid Res.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1194/jlr.M200359-JLR200 on November 4, 2002

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M200359-JLR200v1
44/2/303    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodeur, H.
Right arrow Articles by Bhat, P. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodeur, H.
Right arrow Articles by Bhat, P. V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Journal of Lipid Research, Vol. 44, 303-313, February 2003
Copyright © 2003 by Lipid Research, Inc.

Cloning of monkey RALDH1 and characterization of retinoid metabolism in monkey kidney proximal tubule cells

Helene Brodeur*,§, Isabelle Gagnon*,§, Sylvie Mader{dagger} and Pangala V. Bhat1,*,§

* Laboratory of Nutrition and Cancer, Universite de Montreal, Montreal, Quebec, Canada
{dagger} Centre hospitalier de l'Universite de Montreal-Hotel Dieu, Departments of Biochemistry, Universite de Montreal, Montreal, Quebec, Canada
§ Medicine, Universite de Montreal, Montreal, Quebec, Canada

Published, JLR Papers in Press, November 4, 2002. DOI 10.1194/jlr.M200359-JLR200

1 To whom correspondence should be addressed. e-mail: bhatp{at}medclin.umontreal.ca


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
All-trans and 9-cis retinoic acids function as ligands for retinoic acid receptors (RARs and RXRs), which are ligand-dependent transcription factors and play important roles in development and cellular differentiation. Several retinal dehydrogenases are likely to contribute to the production of all-trans and 9-cis RAs in vivo, but their respective roles in different tissues are still poorly characterized. We have previously characterized and cloned from kidney tissues the rat retinal dehydrogenase type 1 (RALDH1), which oxidizes all-trans and 9-cis retinal with high efficiency but is inactive with 13-cis retinal. Here we have characterized the retinal-oxidizing activity in monkey JTC12 cells, which are derived from kidney proximal tubules. In vitro assay of cell lysates revealed the presence of a NAD+-dependent dehydrogenase that catalyzed the oxidation of all-trans, 9-cis, and 13-cis retinal. Northern blot analysis of JTC12 RNAs and cloning by reverse transcription-polymerase chain reaction demonstrated expression of a monkey homolog of RALDH1. Bacterially expressed JTC12 RALDH1 catalyzed conversion of all three retinal isomers, with a higher catalytic efficiency for 9-cis retinal than for all-trans and 13-cis retinal. Accordingly, live JTC12 produced 9-cis retinoic acid more efficiently than all-trans retinoic acid from their respective retinal precursors.

Only metabolites corresponding to the same steric conformation were formed from 9-cis or all-trans retinal, indicating a lack of detectable isomerizing activity in JTC12 cells.

Abbreviations: ALDH, aldehyde dehydrogenase; GST, glutathione-S-transferase; HPLC, high-pressure liquid chromatography; RA, retinoic acid; RALDH1, 2, and 3, retinal dehydrogenase type 1, 2, 3; RAR, retinoic acid receptor; RXR, retinoid X receptor; RT-PCR, reverse transcription-polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis

Supplementary key words retinoic acid • retinol • isomers • retinal dehydrogenase type I • retinoid metabolism


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Retinoids are important regulators of cell growth, differentiation, and embryonic development (13). They are also needed for normal vision, reproduction, and immunity (46). The biological actions of retinoids are mediated through binding and modulation of retinoic acid receptors (RARs) or retinoid X receptors (RXRs), which function as ligand-dependent transcription factors (7). All-trans retinoic acid (RA) is a natural ligand for RARs, and 9-cis RA binds to both RARs and RXRs (8). The influence of vitamin A (retinol) in the control of gene expression is made possible by enzymes regulating RA synthesis. RA is formed from retinol via a 2-step metabolic pathway that involves oxidation of retinol to retinal and then of retinal to RA (9, 10). Although the metabolic pathways leading to the formation of all-trans and 9-cis RAs are beginning to be elucidated, the enzymes controlling production of these compounds within specific cells and tissues are still poorly characterized. In particular, it is not firmly established whether both all-trans and 9-cis RAs can be produced from the precursor all-trans retinol. Several studies have shown that externally supplied all-trans, 9-cis, and 13-cis RAs are isomerized into cis or trans RAs in cells and tissues and appear to reach equilibrium (1116). Since no isomerase(s) involved in these processes have been identified, it is generally believed that the interconversion of cis-trans RA occurs in cells through nonenzymatic mechanism(s), although it is not clear whether this can happen at the level of retinol, retinal, and/or retinoic acid (16, 17).

We have previously reported the purification, cloning, and characterization of a retinal dehydrogenase type 1 (RALDH1) from rat kidney that oxidized all-trans and 9-cis retinal, but not 13-cis retinal to the corresponding acids (1820). We have also demonstrated that rat RALDH1 is highly expressed in the proximal tubules of the developing kidney, suggesting a role in RA production during tubulogenesis (21). In addition, rat RALDH1 is expressed in other tissues such as trachea, intestine, and stomach epithelia, indicating its role in RA production needed for epithelial cell differentiation (22, 23). In humans, RALDH1 is highly expressed in kidney and liver tissues (24). On the other hand, in the mouse, RALDH1 is detected in mesonephros of 10-day-old embryo but is not expressed in the adult kidney (25).

In the present report, we have characterized the RALDH expressed in a monkey kidney cell line (JTC12) and investigated the production of isomers of RA by these cells. The enzyme cloned was found to be the most homologous to human RALDH1. Its expression in kidney JTC12 cells is consistent with the reported high expression of rat RALDH1 in kidney. In addition, monkey RALDH catalyzed formation of all-trans, 9-cis, or 13-cis isomers of RA from the corresponding retinal isomers in vitro, with a 2-fold higher catalytic efficiency for 9-cis retinal. Similarly, 9-cis RA was formed more efficiently than all-trans RA when JTC12 cells were incubated with all-trans or 9-cis retinal, respectively, without detectable equilibrium between RA isomers.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and reagents
All-trans, 9-cis, and 13-cis retinal, and all-trans and 13-cis RAs were purchased from Sigma Chemical Co. (St. Louis, MO). Standard all-trans, 9-cis, and 13-cis retinol were synthesized from corresponding retinal by NaBH4 reduction as described earlier (26). 9-cis RA was obtained from Hoffmann-La Roche (Basel, Switzerland). The purity of the retinal substrates was assessed by reverse and normal phase high-pressure liquid chromatography (HPLC) (27) and was found to be at least 99% pure. All HPLC-grade solvents were purchased from the Fisher Scientific Co. (Toronto, Ontario).

Cell culture
JTC12 (monkey kidney proximal tubule) cells were cultured in Dulbecco's modified Eagle's medium (Gibco BRL) supplemented with 10% (v/v) fetal bovine serum, high glucose, and antibiotics penicillin and streptomycin (Sigma) at 37°C in an incubator containing 5% CO2.

Northern blot analysis
Expression of RALDH transcripts in JTC12 cells was analyzed by Northern blot essentially as described earlier (22). Total RNAs from cells were isolated with Trizol pure reagent (Gibco BRL) according to the manufacturer's protocol. Ten to fifteen micrograms of total RNA were separated in 1.1% agarose gels and transferred to a Nytran membrane. The blots were prehybridized and hybridized at 68°C using Quickhyb reagent (Stratagene, La Jolla, CA). They were then washed twice with 2x SSC, 0.1% SDS at room temperature for 15 min, and then with 0.1x SSC, 0.1% SDS at 50°C for 30 min (low-stringent condition). Under high-stringent conditions, the blots were washed with 0.1x SSC, 0.1% SDS at 65°C for 30 min. Full-length rat kidney RALDH cDNA that was labeled with [32P]dCTP served as a probe.

Immunoblot analysis
For immunoblot analysis, cells and tissues were homogenized in 1.0 ml of 100 mM ice-cold Tris-HCl buffer, pH 8.0, containing 3 mM EDTA and a mixture of protease inhibitors. The homogenate was centrifuged at 10,000 g to remove debris and unhomogenized materials. The protein present in the supernatant was boiled in sample buffer, separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to Hybond nitrocellulose (Amersham). Blots were blocked with 0.05% Tween-20 in 5% BSA before incubation with an antibody. Immunoreactive protein was detected in an ECL Western blotting system. An antibody raised against rat RALDH1 (peptide corresponding to residues 5–16) (28) (kindly supplied by Dr. James Lipsky, Mayo Clinic Foundation, Rochester, MN) was used in immunoblot analysis.

Cloning of cDNA
Monkey RALDH1 cDNA was cloned from JTC12 total RNA by reverse transcription-polymerase chain reaction (RT-PCR). The primers from human RALDH1 sequence were used in RT-PCR (29). The forward and reverse primers consist of the BamHI restriction site and 5'-sequences (oligos 1–20, atgtcatcctcaggcacgcc), and an EcoRI restriction site and the reverse complement of 3'-sequences (oligos 1487–1506, ctctcagaagaactcataa) respectively. First strand cDNA was synthesized with 2 µg of RNA from JTC12 cells using M-MLV reverse transcriptase (Gibco BRL) and 3'-primer. This was followed by a PCR that contained both 5'- and 3'-primers and Taq polymerase using Super Script system (Gibco BRL). The PCR product was separated on 1% agarose gel, and a 1.5-kb band was isolated on DE 81 paper. The 1.5-kb PCR product that contained the RALDH open reading frame was subcloned into the BamHI and EcoRI sites of the pGEX-2T bacterial expression vector (Pharmacia Biotech). Two clones originating from independent PCR reactions were sequenced.

Recombinant RALDH expression and purification
The RALDH1 clone in pGEX-2T vector was transformed into Escherichia coli BL21 (DE3) and expressed with glutathione-S-transferase (GST) fusion protein at the N terminus. The expressed protein was purified from crude bacterial extract with a GST affinity column followed by excision with thrombin as described previously (30). The purity of the enzyme was assessed by SDS-PAGE.

RALDH activity assays
Assays for monkey RALDH1 activity were carried out essentially as described previously for rat kidney RALDH1 (31). Cell lysates or tissue extracts were incubated for 60 min at 25°C with an assay mixture (250 µl) containing 10 µM each of all-trans, 9-cis, or 13-cis retinal (added in 2.5 µl dimethyl sulfoxide), and 603 µM NAD+ in 100 mM phosphate buffer, pH 7.5, containing 0.02% Tween-80 and 161 mM dithiothreitol. To determine the kinetic constants of purified recombinant RALDH, various concentrations of retinal substrates (1–20 µM) were incubated with a fixed amount of enzyme. Immediately after the reactions, the assay mixture was extracted with 400 µl of butanol-acetonitrile (1:1, v/v), and the reaction product was analyzed by HPLC. Assays were performed under yellow light or in minimal light to minimize the photoisomerization of retinoids.

Retinoid metabolism by JTC12 cells
Cells at least 70% confluent were used in retinoid metabolism studies. In cytotoxic assays and titration experiments, 2.5 million cells in 10 cm dishes were incubated with 1 µM, 5 µM, or 10 µM all-trans retinal for 24 h. In later experiments, cells were incubated for 3 h with 10 µM all-trans, 9-cis, or 13-cis retinal. Retinoids were freshly prepared in ethanol, and their purity was checked by UV spectrum and HPLC before their addition to the medium. Formalin-fixed cells served for control incubations with retinoids. After incubations with retinoids, the medium was removed and the cells were washed twice with cold phosphate-buffered saline (PBS). They were then collected from the dish by scraping, and suspended in 0.5 ml PBS. Cell lysates were prepared by freezing and thawing three times. After gently vortexing for a few seconds, the samples were centrifuged at 2,000 rpm for 15 min at 4°C to remove cell debris, and supernatants were collected. Retinal, retinol, and RA were extracted from the cell lysates (250 µl) with butanol-acetonitrile (400 µl, 1:1). An aliquot was directly injected onto HPLC for the separation and quantification of retinoids. To detect the formation of retinyl esters, the lysates were extracted twice with 3 ml of petroleum ether. Retinyl esters were separated by alumina column chromatography as described earlier (32), and their identities were verified by spectrophotometry and HPLC (33).

HPLC analysis
RA, retinol, and retinal were separated on a 4.6 x 250 mm Partisil 10 µ ODS (irregular shaped, 10% carbon loading from Phenomenex, Inc., Torrance, CA) with acetonitrile-water (40:60, v/v) containing 10 mM ammonium acetate as the mobile phase and at a flow rate of 1.2 ml/min. In this HPLC system, cis-retinoids are not separated from each other but are separated from their respective trans-retinoids. The identity of each cis-retinoid isomer (9-cis and 13-cis) and the formation of retinyl esters were studied in other HPLC systems described earlier (33, 34). Retinoids were detected by absorbance at 330 nm on a Shimatzu LC-7A liquid chromatography system. Retinoid peaks were identified and quantified by comparing their retention times and integrated areas under the peak against those of known amounts of pure standard retinoids.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of the RALDH expressed in JTC12 cells
Northern blot analysis of RNA extracted from JTC12 cells under low-stringency conditions using full-length rat kidney RALDH1 cDNA as a probe revealed an abundant ~2.2 kb transcript (Fig. 1A) . The size of the transcript was slightly higher than that of rat kidney RALDH1 (Fig. 1A, lane 2). However, under high-stringency conditions, the probe hybridized with rat RALDH1 but not with the transcript from JTC12 cells, suggesting differences in primary sequences between the two mRNAs. Western blot analysis using anti-rat RALDH1 showed no signal (data not presented), indicating that the peptide sequence of JTC12 ALDH differs from that of rat RALDH1 between amino acids 5–16, the epitope recognized by the antibody. Note, however, that this antibody does not recognize human RALDH1, due to sequence divergence in this epitope. We next examined whether the JTC12 ALDH transcript hybridizes with other cytosolic ALDHs, such as RALDH2 and RALDH3, which also catalyze retinal oxidation (30, 35). A cDNA probe corresponding to mouse RALDH2 did not hybridize, and a mouse RALDH3 probe recognized only a faint doublet around 3 kb (data not presented), suggesting that the main ALDH found in JTC12 cells is the monkey homolog of the RALDH1.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. A: Northern analysis of total RNA (10 µg) from JTC12 cells (lane 1) and adult rat kidney (lane 2). The blot was hybridized under low stringent conditions as described in Materials and Methods. B: Retinal-oxidizing activity in extracts from JTC12 cells and adult rat kidney. Seventy-five micrograms of crude protein extract and 10 µM of all-trans retinal were used in the assay.

 
To test whether the JTC12 ALDH has activity with retinal substrates, we performed retinal dehydrogenase assays in crude cell extracts, using initially all-trans retinal as substrate. Similar to rat kidney extracts, the JTC12 cell extracts showed high NAD-dependent RA-synthesizing activity (Fig. 1B). The ability of JTC12 cell extracts to catalyze the oxidation of all-trans, 9-cis, and 13-cis retinal was examined to compare the substrate selectivity of the RALDH expressed in these cells with those reported for human, mouse, or rat RALDH1. While all three enzymes catalyze oxidation of all-trans and 9-cis retinal, they differ in their properties with 13-cis retinal, which is a substrate only for human RALDH1. The rates of RA production using JTC12 cell extracts were linear to protein concentrations up to 75 µg. The RALDH present in these extracts had high activity with 9-cis retinal, and slightly lower activity with all-trans and 13-cis retinal (Fig. 2) . Thus, the substrate selectivity of the JTC12 RALDH with 13-cis retinal is closer to that of the human enzyme than to those of the rodent enzymes.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. Rates of retinoic acid (RA) synthesis from 9-cis (circle), all-trans (square), or 13-cis (triangle) retinal with increasing protein concentrations. Various concentrations of crude protein extract from JTC12 cells were incubated with 10 µM of retinal isomers at 25°C for 1 h. Each point in the curve represents the average of triplicate values.

 
Together, the results of the Northern/Western experiments and of the enzymatic assays suggest that the RALDH expressed in JTC12 cells is most closely related to human RALDH1 (19, 36).

Kinetic properties of the recombinant JTC12 RALDH
Since the initial characterization of the JTC12 RALDH indicated high similarity with human RALDH1, we used 5'-and 3'-primers derived from human ALDH1 in a RT-PCR assay to clone the cDNA corresponding to the monkey enzyme. The cDNA obtained encoded a deduced protein of 500 amino acids (Fig. 3) with closest amino acid identity with human ALDH1 (98.6%) (29). Monkey RALDH1 also shared 85.6% and 86.2% amino acid identity with rat and mouse RALDH1, respectively (Fig. 4) . Note that 9 amino acids out of 12 differ between monkey RALDH1 and rat RALDH1 in the N-terminal epitope recognized by the antibody used in Western blotting, explaining its lack of cross-reactivity with JTC12 extracts.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 3. Nucleotide and deduced amino acid sequences of the monkey retinal dehydrogenase type 1 (RALDH1) open reading frame. The amino acids that are different from human aldehyde dehydrogenase (ALDH)1 are indicated in bold. Sequence data have been deposited with the GenBank accession number AF542418.

 


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Comparison of amino acid sequences of monkey RALDH1 (moRALDH1) with other ALDH family members. Sequence identity between ALDHs is indicated by dashes. hALDH1, rRALDH1, and mRALDH1 represent human, rat, and mouse RALDHs, respectively. Sequences were obtained from GenBank accession numbers: hALDH1 NM000689, rRALDH1 L42009, and mRALDH1 NM 013467.

 
To investigate whether the cloned cDNA expresses a protein with enzymatic properties for retinal oxidation similar to those observed with crude extracts, we expressed it in an E. coli system. The purified recombinant enzyme showed an expected molecular mass of 55 kDa (Fig. 5) . The pH optimum of the expressed enzyme for all-trans retinal oxidation was nine (Fig. 6B) , similar to the pH optimum of the enzyme characterized in crude extracts (Fig. 6A). Next, we tested the activity of recombinant RALDH for retinal isomer substrates. Similarly to the activity observed in crude cell extracts (Fig. 2), the E. coli-expressed enzyme also catalyzed oxidation of the three retinal isomer substrates to the respective RAs (data not presented).



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 5. Expression of monkey RALDH1 in E. coli. Lane 1, molecular weight markers; lane 2, bacterial lysate transfected with the empty vector; lanes 3 and 4, whole bacterial extracts from BL21 (DE3) cells transformed with the pGEX-2T-RALDH1 expression vector and purified enzyme by glutathion-Speharose followed by excision with thrombin respectively. Proteins (6 µg) were loaded on an SDS-polyacrylamide gel (10%) and visualized by 0.05% Coomassie Brilliant blue.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. The pH optimum for all-trans RA synthesis is similar for native and recombinant monkey RALDH1. Thirty-five micrograms and 0.6 µg respectively of crude extract (A) and pure recombinant proteins (B) were used in the assay. The reaction was performed with 10 µM of all-trans retinal. Each point is the average of triplicate values. Square, phosphate buffer 0.1 mM, pH 7–8; circle, Tris-HCl buffer 0.1 mM, pH 7.5–9.0; triangle, bicarbonate buffer 0.1 mM, pH 9–11.

 
To test whether the kinetic properties of recombinant JTC12 RALDH for retinal substrates are similar to those of human ALDH1 (36), we assessed its saturation kinetics with all-trans, 9-cis, and 13-cis retinal. The recombinant enzyme exhibited the highest activity for 9-cis retinal followed by all-trans and 13-cis retinal oxidation (Fig. 7) . The Km for 13-cis retinal was 2-fold lower than for all-trans retinal. However, no significant difference was observed in the catalytic efficiency (Vmax/Km) of 13-cis and all-trans retinal conversion to the respective RAs (Table 1). On the other hand, 9-cis retinal showed ~2-fold higher catalytic efficiency when compared with all-trans retinal oxidation. Overall, the kinetic properties were similar to those of purified human ALDH1 (36).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Saturation kinetics of recombinant monkey RALDH1 for retinal isomers. Assays were performed with 0.4 µg of recombinant protein. Circle, 9-cis; square, all-trans; and triangle, 13-cis retinal. Each point in the curves represents the average of three replicates.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Substrate specificities of recombinant RALDH of JTC12 cells for retinal isomers

 
Metabolism of retinal isomers by JTC12 cells
The presence of trace amounts of retinal, the intermediate in the synthesis of RA from retinol, has been demonstrated in tissues (37). However, little is known about whether stereochemical integrity is maintained in cells during RA metabolism. Since JTC12 cells express high levels of an RALDH that is capable of oxidizing all-trans, 9-cis, and 13-cis retinal, metabolic studies performed with these cells should provide valuable information as to the possibility of intracellular conversion between retinal isomers.

In initial experiments, JTC12 cells were incubated for 24 h with various concentrations of all-trans retinal (1–10 µM) to assess the sensitivity of the HPLC assay for detection of RA produced, and the potential toxicity of the retinal substrate. Cell viability was examined by trypan blue exclusion and indicated that the retinal concentrations used were not toxic. Since a dose-dependent increase in RA levels was observed in this range of concentrations (Fig. 8) , more detailed metabolic studies were then performed in JTC12 cells using 10 µM of retinal isomers. The purity of all-trans, 9-cis, and 13-cis retinal substrates before incubation was found to be greater than 99% by HPLC analysis (Fig. 9A, B, C , respectively). All retinoid-containing solutions were prepared in the dark just before incubation. The typical HPLC profiles of the lipid extracts from cells incubated with all-trans, 9-cis, or 13-cis retinal for 3 h are presented in Fig. 9D, E, and F, respectively. The cells took up all-trans retinal from the medium and converted it into either all-trans retinol or all-trans RA (Fig. 9D, peaks 2 and 4), while no cis isomers of retinol or RA were detected. Interestingly, we did not detect retinal in cell extracts, indicative of its complete metabolism. Similarly, 3 h of incubation with 9-cis retinal resulted in the formation of 9-cis RA by the cells (Fig. 9E, peak 1), and neither all-trans RA nor all-trans retinal were produced. Note that 9-cis retinol was not detected either. In parallel experiments, cells pre-treated with formaldehyde for 1 min (dead cells) did not produce any metabolites of all-trans or 9-cis retinal, indicating that metabolites were formed in the cells. On the other hand, the metabolic profile of 13-cis retinal showed formation of all-trans RA, all-trans retinol, and all-trans retinal with no 13-cis RA or 13-cis retinol (Fig. 9F), while trace amounts of 13-cis retinal were still present in the cells (Fig. 9F, peak 7). Since mainly all-trans retinoid metabolites were present in cells incubated with 13-cis retinal, one possibility is that most of the 13-cis retinal might have been isomerized nonspecifically in the medium to all-trans retinal, and that all-trans retinal might have been preferentially taken up by the cells and metabolized to the respective RA or retinol. To explore this possibility, we incubated formalin-fixed cells with 13-cis retinal and analyzed the retinoids extracted from the medium. Indeed, more than 45% of 13-cis retinal was isomerized to all-trans retinal in the medium at 3 h of incubation (data not shown). At present, we have not succeeded in keeping the integrity of the steric configuration of 13-cis retinal in the incubation medium, thus preventing assessment of the metabolism of 13-cis retinal in JTC12.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 8. Levels of RA synthesized in JTC12 cells incubated with various concentrations of all-trans retinal. All-trans retinal was added to the culture medium in 5 µl (0.1% final concentration in medium) ethanol and incubated for 24 h. RA was extracted from the cells and analyzed by high-pressure liquid chromatography (HPLC) as described in Materials and Methods.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 9. Representative HPLC chromatograms of standard retinal isomers (upper panel) and their metabolites generated in JTC12 cells (lower panel). Arrows 5, 6, and 7 indicate the elution positions as well as the purity of the all-trans (A), 9-cis (B), and 13-cis (C) retinal standards that were used in the metabolic studies. D–F: Represent the metabolic profiles of cells incubated with all-trans, 9-cis, and 13-cis retinal for 3 h, respectively. Arrow 1 represents the elution position of 9-cis and 13-cis RA; 2, all-trans RA; 3, 9-cis and 13-cis retinol; and 4, all-trans retinol.

 
Although the presence of retinyl esters was not routinely examined because of the need to use relatively tedious chromatographic systems to separate and quantify the isomers of retinyl esters, alumina chromatography and HPLC analysis demonstrated the presence of retinyl esters in cells incubated with all three retinal isomers (data not shown), indicating that JTC12 cells express retinyl esterases and store retinol in the form of retinyl esters.

The levels of all-trans or 9-cis RA or retinol formed in cells incubated for 3 h with all-trans or 9-cis retinal, respectively, is illustrated in Fig. 10 . At 3 h of incubation, the cellular levels of 9-cis RA were 5-fold higher than of all-trans RA, while all-trans retinol accumulated more than 9-cis retinol over the same time period. This higher efficiency in the conversion of 9-cis retinal to RA than of the all-trans isomer is consistent with the in vitro properties of the monkey RALDH1.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 10. Biosynthesis of RA and retinol from retinal precursors in JTC12 cells. JTC12 cells were grown in medium supplemented with 10 µM all-trans or 9-cis retinal for 3 h. RA (A) or retinol (B) metabolites were measured by HPLC. The results represent the mean value of triplicate experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although a wealth of information is available on the role of retinoid receptors in retinoid signaling, less is known about the metabolic pathways involved in the biosynthesis of RA isomers in target tissues. To analyze the biosynthetic pathways of retinoid isomers in an intact cell system, we characterized the RA synthetic enzyme expressed in a kidney-derived cell line, JTC12. The expression levels and activity for the three retinal isomers of the RALDH enzyme expressed in JTC12 cells suggested that JTC12 is a good model to explore the biosynthesis of RA isomers in a cellular environment.

We have previously reported the kinetic properties of several RALDHs for retinal isomer substrates (19, 30, 36), and characterized the amino acid regions that are important for all-trans and 9-cis retinal oxidation (38). The observation that the JTC12 RALDH activity catalyzed the oxidation of the three retinal isomer substrates (Fig. 2), and the lack of hybridization with a probe for RALDH2, which also oxidizes the three retinal isomers (30), indicated that this activity is most similar to human ALDH1 (36). This homology was confirmed by sequencing of the cloned cDNA (Fig. 3), and the properties of the recombinant enzyme, such as molecular mass (Fig. 5), pH optimum (Fig. 6), and kinetic constants (Fig. 7, Table 1), were found to be very similar to those of human ALDH1 (36). Furthermore, the transcript (~2.2 kb) that hybridized with rat kidney RALDH1 cDNA at low stringency (Fig. 1) hybridized strongly with the cloned cDNA under high-stringency conditions (data not shown), confirming that the cloned monkey RALDH1 is indeed the retinal dehydrogenase expressed to high levels in JTC12 cells.

One aspect of retinoid signaling that is not yet clear is the metabolic route of all-trans, 9-cis, and 13-cis RA formation in vivo. It is generally accepted that all-trans retinol is the main precursor retinoid for the formation of RAs in vivo (39). Note in addition that, while it is generally believed that all-trans and 13-cis RA are naturally occurring retinoid forms (17, 38), the occurrence of 9-cis RA in tissues and cells is still disputed (8, 4043). However, the existence of 9-cis and 13-cis retinol has been documented (19, 39). Several enzymes involved in the first oxidation step of the RA biosynthetic pathway have been shown to catalyze the oxidation of all-trans, 9-cis, and 13-cis retinol to the respective retinals (9, 10, 44). In the second step of RA synthesis, retinal is oxidized by at least three types of NAD+-dependent RALDHs differing in tissue expression and catalytic efficiencies for retinal isomers (9). Enzymatic assays have clearly demonstrated that the retinoids maintain their steric configuration during the oxidation process of retinol to RA in vitro using either pure or recombinant enzymes (19, 30, 39). However, the metabolism of retinoids within tissues and cells is complex. Retinol taken up by the cells undergoes various metabolic transformations that include esterification to retinyl esters, activation to RA, and conjugation to glucuronic acid (9, 10, 45). Since JTC12 cells constitutively express high levels of an RALDH activity that catalyzes oxidation of all three retinal isomers into the corresponding RA isomers in vitro, we wanted to characterize the metabolites formed from each isoform of retinal and to assess whether isomerization can occur in live JTC12 cells.

HPLC analysis of cell extracts incubated with retinal isomers showed a dose-dependent production of RA produced in JTC12 cells (Fig. 8). Although retinal can form Schiff's bases with groups of proteins and amino acids (46), no cytotoxicity was observed at the concentrations used. In addition to oxidation to RA, all-trans retinal was also reduced to retinol (Fig. 9, peak 4) and subsequently esterified (data not included), suggesting the presence of retinol reductase and esterase in JTC12 cells. Since the first metabolic conversion of retinol to RA is a reversible reaction, the reductase may well represent a retinol dehydrogenase (10). Several investigators have reported that reduction to retinol and subsequent esterification to retinyl esters are the main metabolic products of administered retinal isomers in cells and tissues (39, 47). However, no retinol was detected after a 3 h incubation period with 9-cis retinal, while high levels of 9-cis RA were produced compared with all-trans RA (Fig. 10A), consistent with the substrate selectivity observed with recombinant RALDH1 in vitro (Fig. 7, Table 1). It is interesting that neither all-trans nor 9-cis retinal was detectable in the cells (Fig. 9D, E), indicating rapid exhaustion of the substrate by oxidative and reductive enzymes.

In vivo, retinal is formed either from the oxidation of retinol or cleavage of ß-carotene. However, the bulk of retinal generated from ß-carotene is converted to retinol and then to retinyl esters, which are stored in peripheral target cells, or in the case of intestinal uptake, are transported by chylomicrons to the liver and subsequently stored in stellate cells (48). The rates of cleavage of 9-cis and 13-cis ß-carotene are slower than that of the all-trans isomer (49). This may affect the rates of conversion of retinal isomers, formed from carotenoid precursors, to either retinol or RA. In addition, the expression levels and the substrate specificities of RALDHs and reductases may influence the metabolism of retinal isomers. Our experiments on retinal metabolism by JTC12 cells support the notion that the synthesis of either RA or retinol from retinal depends on the relative activities and specificities of RALDHs and retinal reductases for retinal substrates. Since retinal does not exist in free form in the cells, it is likely that retinal taken up by the cells is metabolized rapidly either to RA or retinol.

A recent study demonstrated that all-trans RA is a major metabolite of 13-cis retinal in pregnant rats supplemented with 13-cis retinal (47). We also observed production of all-trans metabolites in JTC12 cells incubated with 13-cis retinal, but this isomerization could be attributed to the significant conversion of 13-cis retinal to all-trans retinal in culture media (Fig. 9F). To examine whether 13-cis retinal maintains its steric configuration during metabolic conversion in the cells requires methods to stabilize it during incubation. Nevertheless, this problem was not encountered with all-trans or 9-cis retinal, which were converted to their respective metabolites without detectable isomerization by live JTC12 cells (Fig. 9). Several studies have shown that isomerization of the trans and cis isomers of externally provided RAs varies between 2% and 15% of total RA in tissues, cells, and microsomal extracts (1115). Note that the detection limit of RAs in our HPLC systems is 1 pmol, which represents about 7.5% of the all-trans RA and 1.5% of the 9-cis RA produced in an assay of JTC12 cell extracts after in vivo incubation (Fig. 10A). Thus, if conversion of 9-cis to all-trans RA takes place in JTC12 cells, it occurs with very low efficiency. These observations are consistent with the findings of Sass et al. (47) and Kraft et al. (50), who reported that all-trans and 9-cis RA are the predominant in vivo metabolites of administered all-trans and 9-cis retinal, respectively. Furthermore, Liu et al. (51) demonstrated that parathyroid cells do not convert all-trans RA to 9-cis RA, but synthesize 9-cis RA from all-trans retinol. Taken together, these observations suggest that RA isomers are generated in target cells from different precursor retinoids rather than by isomeric exchange. Future studies directed toward the generation and use of selective retinal isomer-oxidizing enzymes (38) in in vitro transfection protocols as well as in an in vivo-expressing transgenic mouse system should provide greater insights into the formation and metabolic conversion of RAs.


    ACKNOWLEDGMENTS
 
This work was supported by a grant from the Canadian Institutes of Health Research (MOP-36485) to P.V.B. and S.M. The authors thank Sharmeen Nusrat for excellent technical assistance and Ovid M. Da Silva for editing our manuscript.

Manuscript received September 6, 2002 and in revised form October 29, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
  1. Strickland, S., and M. J. Sawey. 1980. Studies on the effect of retinoids on the differentiation of teratocarcinoma stem cells in vitro and in vivo. Dev. Biol. 78: 76–85.[CrossRef][Medline]

  2. Gudas, L. J., M. B. Sporn, and A. B. Roberts. 1994. Cellular biology and chemistry of the retinoids. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, editors. Raven Press Ltd, New York. 443–520.

  3. Hofmann, C., and G. Eichele. 1994. Retinoids in development. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, Editors. Raven Press Ltd, New York. 319–350.

  4. Saari, J. C. 1994. Retinoids in photosensitive systems. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, editors. Raven Press Ltd, New York. 351–386.

  5. Armstrong, R. B., K. O. Ashenfelter, C. Eckhoff, A. A. Levin, and S. S. Shapiro. 1994. General and reproductive toxicology of retinoids. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, editors. Raven Press Ltd, New York. 545–572.

  6. Ross, A. C., and U. Hammerling. 1994. Retinoids and the immune system. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, editors. Raven Press Ltd, New York. 521–544.

  7. Chambon, P. 1995. A decade of molecular biology of retinoic acid receptors. FASEB J. 10: 940–954.[Abstract]

  8. Mangelsdorf, D. J., K. Umesono, and R. M. Evans. 1994. The retinoid receptors. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, editors. Raven Press Ltd, New York. 319–349.

  9. Duester, G. 2000. Families of retinoid dehydrogenases regulating vitamin A function: production of visual pigment and retinoic acid. Eur. J. Biochem. 267: 4315–4324.[Medline]

  10. Napoli, J. L. 2000. Retinoic acid: its biosynthesis and metabolism. Prog. Nucleic Acid Res. 63: 139–188.

  11. Sundaresan, P. R., and P. V. Bhat. 1982. Ion-pair high-pressure liquid chromatography of cis-trans isomers of retinoic acid in tissues of vitamin A sufficient rats. J. Lipid Res. 23: 448–455.[Abstract]

  12. Cullum, M. E., and M. H. Zile. 1985. Metabolism of all-trans retinoic acid and all-trans retinyl acetate: demonstration of common physiological metabolites in rat small intestinal mucosa and circulation. J. Biol. Chem. 260: 10590–10596.[Abstract/Free Full Text]

  13. Bhat, P. V., and A. M. Jetten. 1987. Metabolism of all-trans retinol and all-trans retinoic acid in rabbit tracheal epithelial cells in culture. Biochim. Biophys. Acta. 922: 18–27.[Medline]

  14. Kojima, R., T. Fujimore, N. Kiyota, Y. Toriya, T. Fukuda, T. Ohashi, T. Sato, Y. Yoshizawa, K. I. Takeyama, H. Mano, S. Masushige, and S. Kato. 1994. In vivo isomerization of retinoic acids: rapid isomer exchange and gene expression. J. Biol. Chem. 269: 32700–32707.[Abstract/Free Full Text]

  15. Urbach, J., and R. R. Rando. 1994. Isomerization of all-trans retinoic acid to 9-cis retinoic acid. Biochem. J. 299: 459–465.

  16. Disdier, B., M. N. Marchetti, H. Bun, M. Placidi, and A. Durand. 2000. Kinetics of plasma and tissue distribution of 9-cis retinoic acid in rats. Skin Pharmacol. Appl. Skin Physiol. 13: 9–16.[CrossRef][Medline]

  17. Blaner, W. S. 2001. Cellular metabolism and actions of 13-cis retinoic acid. J. Am. Acad. Dermatol. 45: S129–S135.[CrossRef][Medline]

  18. Labrecque, J., P. V. Bhat, and A. Lacroix. 1993. Purification and partial characterization of a rat kidney aldehyde dehydrogenase that oxidizes retinal to retinoic acid. Biochem. Cell Biol. 71: 85–89.[Medline]

  19. Labrecque, J., F. Dumas, A. Lacroix, and P. V. Bhat. 1995. A novel isozyme of aldehyde dehydrogenase specifically involved in the biosynthesis of 9-cis and all-trans retinoic acid. Biochem. J. 305: 681–684.

  20. Bhat, P. V., J. Labrecque, J-M. Boutin, A. Lacroix, and A. Yoshida. 1995. Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation. Gene. 166: 303–306.[CrossRef][Medline]

  21. Bhat, P. V., M. Marcinkiewicz, Y. Li, and S. Mader. 1998. Changing patterns of renal retinal dehydrogenase expression parallel nephron development in the rat. J. Histochem. Cytochem. 46: 1025–1032.[Abstract/Free Full Text]

  22. Bhat, P. V. 1998. Retinal dehydrogenase gene expression in stomach and small intestine of rats during postnatal development and in vitamin A deficiency. FEBS Lett. 426: 260–262.[CrossRef][Medline]

  23. Frota-Ruchon, A., M. Marcinkiewicz, and P. V. Bhat. 2000. Localization of retinal dehydrogenase type 1 in the stomach and intestine. Cell Tissue Res. 302: 397–400.[CrossRef][Medline]

  24. Ambroziak, W., I. Gonzalo, and R. Pietruszko. 1999. Metabolism of retinaldehyde and other aldehydes in soluble extracts of human liver and kidney. J. Biol. Chem. 274: 33366–33373.[Abstract/Free Full Text]

  25. Haselbeck, R. J., H. Ines, and G. Duester. 1999. Distinct functions for Aldh1 and Raldh2 in the control of ligand production for embryonic retinoid signaling pathways. Dev. Genet. 25: 353–364.[CrossRef][Medline]

  26. Bhat, P. V., H. T. Co, and A. Lacroix. 1983. Effect of 2-alkanols on the separation of geometric isomers of retinol in non-aqueous high-performance liquid chromatography. J. Chromatogr. 260: 129–134.[CrossRef][Medline]

  27. Bhat, P. V., and P. R. Sundaresan. 1988. High-performance liquid chromatography of vitamin A compounds. CRC Critical Rev. Anal. Chem. 20: 197–219.

  28. Kathmann, E. C., S. Naylor, and J. J. Lipsky. 2000. Rat liver constitutive and phenobarbital-induced cytosolic aldehyde dehydrogenases are highly homologous proteins that function as distinct isozymes. Biochemistry. 39: 11170–11176.[CrossRef][Medline]

  29. Strausberg, R. 2000. Homo sapiens aldehyde dehydrogenase 1 family, member A1 (ALDH1A1) mRNA. GenBank accession no. gi: 4502030.

  30. Gagnon, I., G. Duester, and P. V. Bhat. 2002. Kinetic analysis of mouse retinal dehydrogenase type-2 (RALDH2) for retinal substrates. Biochim. Biophys. Acta. 1506: 156–162.

  31. Bhat, P. V., L. Poissant, and A. Lacroix. 1998. Properties of retinal-oxidizing enzyme activity in rat kidney. Biochim. Biophys. Acta. 967: 211–217.

  32. Bhat, P. V., L. M. De Luca, S. Adamo, I. Akalovsky, C. S. Silverman-Jones, and G. L. Peck. 1979. Retinoid metabolism in spontaneously transformed mouse fibroblasts (Balb/c 3T12–3 cells): enzymatic conversion of retinol to anhydroretinol. J. Lipid Res. 20: 357–362.[Abstract]

  33. Bhat, P. V., L. M. De Luca, and M. L. Wind. 1980. Reverse phase high-pressure liquid chromatographic separation of retinoids, including retinylphosphate and mannosylretinylphosphate. Anal. Biochem. 102: 243–248.[CrossRef][Medline]

  34. Bhat, P. V., and A. Lacroix. 1986. Separation of geometric isomers of retinol and retinoic acid in non-aqueous high-performance liquid chromatography. In Methods in Enzymology. F. Chytil, and D. B. McCormick, editors. Academic Press, Orlando, FL. 75–85.

  35. Griun, F., Y. Hirose, S. Kawauchi, T. Ogura, and K. Umesono. 2000. Aldehyde dehydrogenase 6, a cytosolic retinaldehyde dehydrogenase prominantly expressed in sensory neuroepithelia during development. J. Biol. Chem. 275: 41210–41218.[Abstract/Free Full Text]

  36. Bhat, P. V., and H. Samaha. 1999. Kinetic properties of the human liver cytosolic aldehyde dehydrogenase for retinal isomers. Biochem. Pharmacol. 57: 195–197.[CrossRef][Medline]

  37. Ito, Y. L., M. Zile, M. Ahrens, and H. F. De Luca. 1978. Liquid-gel partition chromatography of vitamin A compounds in biological samples: formation of retinoic acid from retinyl acetate. J. Lipid Res. 15: 517–521.[Abstract]

  38. Montplaisir, V., N. Chow Lan, J. Guimond, C. Savineau, P. V. Bhat, and S. Mader. 2002. Recombinant class I aldehyde dehydrogenases specific for all-trans or 9-cis retinal. J. Biol. Chem. 277: 17486–17492.[Abstract/Free Full Text]

  39. Paik, J., S. Vogel, R. Piantedosi, A. Sykes, W. S. Blaner, and K. Swisshelm. 2000. 9-cis-retinoids: biosynthesis of 9-cis retinoic acid. Biochemistry. 39: 8073–8084.[CrossRef][Medline]

  40. Werner, W. A., and H. F. De Luca. 2001. Metabolism of a physiological amount of all-trans-retinol in vitamin A-deficient rats. Arch. Biochem. Biophys. 393: 262–270.[CrossRef][Medline]

  41. Ulven, S. M., T. E. Gundersen, A. K. Sakhi, J. V. Glover, and R. Blomhoff. 2001. Quantitative axial profiles of retinoic acid in the embryonic mouse spinal cord. Dev. Dyn. 222: 341–353.[CrossRef][Medline]

  42. Ulven, S. M., T. E. Gundersen, M. S. Weedon, V. O. Landaas, A. K. Sakhi, S. H. Fromm, B. A. Geronimo, J. O. Moskaug, and R. Blomhoff. 2000. Identification of endogenous retinoids, enzymes, binding proteins, and receptors during early postimplantation development in mouse: important role of retinal dehydrogenase type 2 in synthesis of all-trans-retinoic acid. Dev. Biol. 220: 379–391.[CrossRef][Medline]

  43. Horton, C., and M. Maden. 1995. Endogenous distribution of retinoids during normal development and teratogenesis in mouse embryo. Dev. Dyn. 202: 312–323.[Medline]

  44. Mertz, J. R., E. Shang, R. Piantedosi, S. Wei., D. J. Wolgemuth, and W. S. Blaner. 1997. Identification and characterization of a stereospecific human enzyme that catalyzes 9-cis retinol oxidation. J. Biol. Chem. 272: 33125–33131.[Abstract/Free Full Text]

  45. Blaner, W. S., and J. A. Olson. 1994. Retinoid and retinoic acid metabolism. In The Retinoids: Biology, Chemistry, and Medicine. M. B. Sporn, A. B. Roberts, and D. S. Goodman, editors. Raven Press Ltd, New York. 229–255.

  46. Nathans, J. 1990. Determinants of visual pigment absorbance: identification of the retinylidene Schiff's base counterion in bovine rhodopsin. Biochemistry. 29: 9746–9752.[CrossRef][Medline]

  47. Sass, J. O., G. Tzimas, M. A. E. Mohamed, and H. Nau. 1999. Metabolism of retinaldehyde isomers in pregnant rats: 13-cis and all-trans-retinaldehyde, but not 9-cis retinaldehyde, yield very similar patterns of retinoid metabolites. Drug Metab. Dispos. 27: 317–321.[Abstract/Free Full Text]

  48. Olson, J. A. 1964. The biosynthesis and metabolism of carotenoids and retinol (vitamin A). J. Lipid Res. 5: 281–299.[Abstract]

  49. Nagao, A., and J. A. Olson. 1994. Enzymatic formation of 9-cis, 13-cis, and all-trans retinals from isomers of ß-carotene. FASEB J. 8: 968–973.[Abstract]

  50. Kraft, J. C., D. Kimelman, and M. R. Juchau. 1995. Xenopus laevis: a model system for the study of embryonic retinoid metabolism. I. Embryonic metabolism of 9-cis-and all-trans retinals and retinols to their corresponding acid forms. Drug Metab. Dispos. 23: 72–82.[Abstract]

  51. Liu, W., P. Hellman, Q. Li, W-R. Yu, C. Juhlin, H. Nordlinder, O. Rollman, G. Akerstrom, H. Törmä, and H. Melhus. 1996. Biosynthesis and function of all-trans- and 9-cis-retinoic acid in parathyroid cells. Biochem. Biophys. Res. Commun. 229: 922–929.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M200359-JLR200v1
44/2/303    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodeur, H.
Right arrow Articles by Bhat, P. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodeur, H.
Right arrow Articles by Bhat, P. V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Molecular and Cellular Proteomics   ASBMB Today 
Advertisement
spacer
Advertisement
Advertisement