J. Lipid Res. Acyl Labeled PIP's available August 1, 2008
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1194/jlr.M400237-JLR200 on September 1, 2004

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M400237-JLR200v1
45/11/1992    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, B.-H.
Right arrow Articles by Unger, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, B.-H.
Right arrow Articles by Unger, R. H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Journal of Lipid Research, Vol. 45, 1992-1999, November 2004
Copyright © 2004 by American Society for Biochemistry and Molecular Biology

Demonstration of reverse fatty acid transport from rat cardiomyocytes

Byung-Hyun Park*, Young Lee*, Marlei Walton{dagger}, Laurence Duplomb* and Roger H. Unger1,*,§

* Gifford Laboratories, Touchstone Center for Diabetes Research, Department of Internal Medicine, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390
{dagger} The Mary Nell and Ralph B. Rogers Magnetic Resonance Center, Department of Radiology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390
§ VA North Texas Health Care System, 4500 South Lancaster Road, Dallas, TX 75216

Published, JLR Papers in Press, September 1, 2004. DOI 10.1194/jlr.M400237-JLR200

1 To whom correspondence should be addressed. e-mail: roger.unger{at}utsouthwestern.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 Materials
 Results
 Discussion
 REFERENCES
 
Fatty acids flow from adipocytes to nonadipose tissues during fasting and exercise and normally are fully oxidized. To determine if nonadipose tissues can export unoxidized FA when FA influx exceeds oxidation, neonatal cardiomyocytes were cultured in 1 µCi 14C-palmitate in the presence of etomoxir to block oxidation. The cells took up and stored 25% of the radioactivity as 14C-triacylglycerol in 12 h, but 4.5% of the label was released in 3 h and comigrated with 14C-palmitate. Both uptake and release of radioactivity were increased by insulin and reduced by the nonspecific inhibitors of FA transporters phloretin and 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Perfused hearts from etomoxir-treated lean rats released 221 ± 59 nmol/10 min of FA. Hearts from high-fat-fed lean rats released 366 ± 172 nmol/10 min (P < 0.05). Hearts from obese rats released 744 ± 260 and 1,578 ± 630 nmol/10 min at 8 and 12 weeks of age, respectively. Perfusion with insulin increased FA release by 32%.

In vitro and ex vivo findings suggest that nonadipose tissues such as myocardium can export FA when the unoxidized lipid content is excessive.

Abbreviations: FABP, fatty acid-binding protein; FAT/CD36, fatty acid transporter; ZDF, Zucker Diabetic Fatty [rat]

Supplementary key words free fatty acid • insulin • liporegulation • triacylglycerol


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
Materials
 Results
 Discussion
 REFERENCES
 
There is increasing evidence that an intracellular surplus of long chain FAs can cause metabolic trauma to the cells of the heart (1, 2), pancreatic islets (3), and perhaps other organs, so-called "lipotoxicity" (4, 5). Increased triacylglycerol (TG) content in nonadipose organs provides a useful index of the magnitude of the lipid surplus in obesity, a common cause of ectopic lipid deposition in animals (4) and humans (6, 7). Although TGs may not be damaging of themselves (8), their presence in excess may indicate the likelihood that other more harmful lipid derivatives are present. Whenever FA uptake and/or production exceeds the oxidative requirements of a cell, unutilized FA may enter deleterious pathways, such as de novo ceramide formation (9). The resulting apoptosis causes a loss of cardiomyocytes and ß-cells, leading, respectively, to lipotoxic cardiomyopathy (1) and noninsulin-dependent diabetes mellitus (3). It seems likely, therefore, that protective mechanisms against such serious consequences of overnutrition would exist.

Compensatory increase in FA oxidation is one protective mechanism that has been proposed (10). There is evidence that, as diet-induced obesity develops, normal adipocytes protect nonadipose tissues from lipotoxicity by secreting adipocytokines, such as leptin and adiponectin, that stimulate FA oxidation (10). A second potentially protective mechanism would be the export of surplus FA from lipid-laden nonadipocytes. The recently proposed secretion of FA as very low density lipoproteins (11) would fall into this category. In the present study, we examined another possible export route, that of reverse FA transport, as a possible exit strategy for the unoxidized lipids. Although export of FA from a nonadipose tissue has never been demonstrated, the concept of reverse FA transport is not new. Myocardial FA release from the human heart has been invoked by several groups to account for discrepancies between arterial and coronary sinus concentrations of radiolabeled and unlabeled FA acids in calculating FA extraction by human (12–15), dog (16), and rat (17) hearts.

Here we provide direct evidence for the existence of reverse FA transport from both isolated rat cardiomyocytes and from the intact rat heart studied ex vivo. The results strongly imply that, under conditions of intracellular overload, and/or when mitochondrial oxidation is impaired, quantitatively important reverse transport of FA can occur. Moreover, the FA export rate is enhanced by insulin. This raises the interesting possibility of a two-way FA flux. During postprandial hyperinsulinemia, the translocation of FA transporters to the surface of lipid-laden nonadipocytes would permit the efflux of unoxidized FA while suppressing lipolysis in adipocytes. Conversely, during fasting and exercise, when insulin levels are low, the familiar flux of FA from adipocytes to nonadipocytes would occur.


   Materials
TOP
 ABSTRACT
 INTRODUCTION
 Materials
Results
 Discussion
 REFERENCES
 
[1-14C]palmitate was obtained from Amersham (Amersham Biosciences, Piscataway, NJ). Essentially FA-free BSA, neutral lipids, phloretin, and DIDS were purchased from Sigma-Aldrich (St. Louis, MO). Etomoxir was obtained from ASAT AG (Switzerland).

Animals
Male obese Zucker Diabetic Fatty (ZDF) homozygous (fa/fa) and lean wild-type rats bred in our laboratory were used in the ex vivo studies. Neonatal Sprague-Dawley rats were used as a source of cardiomyocytes for in vitro culture experiments. Animals were housed in the Dallas, TX, Veterans Affairs Animal Resources Center with a 12 h light/12 h dark cycle, and had access to standard lab chow and water ad libitum. ZDF rats were anesthetized with an intraperitoneal injection of a ketamine-xylazine mixture before administration of etomoxir (5 µmol/100 g of body weight) and again ~1 h later, prior to rapid excision of the heart. All experimental procedures were approved by the Institutional Animal Care and Use Committee at the Veterans Affairs North Texas Health Care System. Animals received either standard chow containing 6% fat or a high-fat diet containing 60% fat.

Cardiomyocyte isolation
A pool of cardiomyocytes was prepared from ten 3 day old Sprague-Dawley rats using a neonatal cardiomyocyte isolation system (Worthington, Lakewood, NJ). Cardiomyocytes (5 x 105 cells) were plated in tissue culture dishes coated with collagen in a 4:1 mixture of DMEM and M199 supplemented with 10% horse serum, 5% fetal calf serum (FCS), 10 U/ml of penicillin, 10 µg/ml of streptomycin, and 2 mM glutamine. Reverse FA transport was assessed in cardiomyocytes after 12 h of incubation. No noticeable loss of cardiomyocytes or change in their function was observed during that time.

Reverse FA transport assay
Cardiomyocytes were preincubated with 10 µM etomoxir for 1 h and then treated with 0.1 mM palmitate containing 1 µCi of 14C-palmitate in the presence or absence of 0.5 mM of phloretin or 0.4 mM DIDS for 12 h in the culture medium. Cells were then washed three times with PBS and radiolabeled FFA release into the culture medium (4:1 mixture of DMEM and M199, 0.5% BSA and antibiotics) was examined over a 3 h period. Lipids from the culture supernatant and cell pellet were extracted and TLC was performed (18).

Thin-layer chromatography (TLC)
Silica gel G preabsorbent thin-layer plates were purchased from Merck (Rahway, NJ), and were used without an activation or washing procedure. All solvents were the best analytical grade. Neutral lipid TLC systems were used with n-heptane-diethyl ether-acetic acid (75:25:4) as the solvent. Cells were extracted with chloroform-methanol (2:1) and reduced to dryness at room temperature under a stream of nitrogen. The residue was dissolved in 0.1 ml chloroform-methanol (2:1 v/v), and spotted onto the TLC plate. Plates were dried and exposed to phosphoimager (Molecular Imager System, GS-363, Bio-Rad, Hercules, CA). The following molecular species of unlabeled neutral lipids were used as standards for the TLC experiments: cholesterol, cholesteryl palmitate, tripalmitin, and palmitate. The plate was run on the same chamber at the same time. After drying, the plate was sprayed with 10% cupric sulfate (w/v) in 8% phosphoric acid (v/v) and heated in an oven at 100°C for 5 min.

Langendorff heart perfusion
After the trimming off of all visible fat and other nonmyocardial tissue, isolated hearts were retrogradely perfused via the aorta at a pressure of 100 cm H2O. The Krebs-Henseleit perfusate contained 118 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4, 1.2 mM NaH2PO4, 25 mM NaHCO3, 1.2 mM CaCl2, 5.5 mM glucose, and 2% FA-free BSA. Perfusate was equilibrated with 95% O2 and 5% CO2 using a thin-film oxygenator. Hearts and perfusate were maintained at 37°C using a water-jacketed system. Left ventricular function was continuously monitored by a pressure transducer inserted into the left ventricle across the mitral valve. Identical perfusate containing 100 nM insulin was perfused for 50 min after 10 min of perfusion without insulin. A T-valve system was used to switch from one perfusate to another. Cardiac effluent was collected in 10 min aliquots from the perfusate surrounding the heart using a pump with the collection line placed just above the heart. After an experiment, all aliquots of effluent were concentrated in a rotary evaporator (SpeedVac: Savant Instruments, Farmingdale, NY; Flexi-Dry microprocessor lyophilizer: FTS Systems, Stone Ridge, NY). FFAs were measured enzymatically using a commercially available kit (NEFA kit: Wako Chemical USA, Richmond, VA). Creatine kinase activity (Diagnostic Chemicals, Charlottetown, Prince Edward Island, Canada) was quantified. To exclude loss of cellular integrity after Langendorff perfusion, heart tissue was fixed in glutaraldehyde, postfixed in osmium tetroxide, and embedded in epoxy resin for examination. Sections were examined under transmission electron microscopy (JEOL USA, Peabody, MA).

Determination of myocardial TG content
A portion of the left ventricle was dissected from the heart after meticulous removal of epicardial adipose tissue by abrasion and scraping. Total lipids were extracted from 0.1 g of tissue as described previously (3). In cardiomyocytes, lipids were extracted in a chloroform-methanol (2:1) mixture and TG was resolubilized from dry material derived from evaporation of the chloroform phase in 30 µl of tert-butyl alcohol and 20 µl of Triton X-100-methyl alcohol mixture (1:1 v/v). TG content was measured with a TG diagnostic kit (Sigma).

Quantitative real-time RT-PCR
To exclude the possibility that the myocardial tissues contained undetected adipocytes, we measured the mRNA of an adipocyte-specific marker, aP2. Total RNA was extracted by the Trizol isolation method according to the manufacturer's protocol (Life Technologies, Gaithersburg, MD). Total RNA (2 µg) was treated with RNase-free DNase (Invitrogen, Carlsbad, CA) and first-strand cDNA was generated with the random hexamer primer in the first-strand cDNA synthesis kit (Applied Biosystems, Foster City, CA). Specific primers for aP2 were designed using primer express software (Applied Biosystems). The primer sequences were GGCTTCGCCACCAGGAA (forward) and CCCTTCTACGCTGATGATCAAGT (reverse). The sequence for the control 18S rRNA was purchased from Applied Biosystems and used as the invariant control. The real-time PCR reaction contained in a final volume of 10 µl, 10 ng of reverse transcribed total RNA, 167 nM of forward and reverse primers, and 2x PCR master mix. PCR reaction was carried out in 384-well plates using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems). All reactions were done in triplicate.

Statistics
Results are reported as mean ± standard deviation. Statistical analysis of the data was performed with Student's t-test.


   Results
TOP
 ABSTRACT
 INTRODUCTION
 Materials
 Results
Discussion
 REFERENCES
 
14C-FA export from cultured cardiomyocytes
To determine if reverse FA transport is demonstrable in cultured neonatal cardiomyocytes, the cells were incubated with 14C-palmitate with etomoxir added to minimize mitochondrial oxidation (Fig. 1). Twelve hours later, 25% of the label was present in the washed cells in the form of TG, with a small amount present as cholesteryl ester. During a subsequent 3 h period of incubation in fresh medium, 4.5% of the intracellular label appeared outside the cells (Fig. 1A). The radioactivity comigrated with 14C-palmitate on TLC (Fig. 1B). In the absence of etomoxir, both the intracellular accumulation of labeled TG and the extracellular appearance of labeled FA were substantially lower, suggesting that both the intracellular accumulation of FA as TG and reverse FA transport are minimal in cardiomyocytes under normal conditions of unimpeded FA oxidation.




View larger version (54K):
[in this window]
[in a new window]
  		Fig. 1. A: Design of experiments in cultured neonatal cardiomyocytes. After a 1 h incubation with 10 µM etomoxir, cardiomyocytes (5 x 105 cells) were cultured for 12 h with 1 µCi of 14C-palmitate in the presence or absence of 100 nM insulin. After washing, the cells were placed in fresh medium for 3 h, after which the intra- and extracellular radioactivity was analyzed. The percentages indicate the distribution of radioactivity at the various steps in the experiments. B: TLC of intracellular and extracellular radioactivity, showing comigration with various lipid fractions.

 
The FA transporter FAT/CD-36 (19) reportedly is translocated by insulin action from an intracellular pool to the plasma membrane, facilitating the transport of long chain FAs into cells (20). When the cardiomyocytes were incubated with insulin in the presence of etomoxir, intracellular TG was increased 2-fold (Fig. 2A), consistent with earlier reports of increased insulin-stimulated FA uptake (20). The appearance of 14C-FA in the medium was also increased 2-fold by insulin (Fig. 2B). Enhancement of both FA import and export by insulin is consistent with insulin-stimulated translocation of a bidirectional transporter that can enhance FA flux into and out of cardiomyocytes, the direction of flow presumably determined by the concentration gradient across the plasma membrane.




View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2. A: Intracellular triacylglycerol (TG) in neonatal cardiomyocytes (5 x 105 cells) treated with 10 µM etomoxir and 100 nM insulin in the presence or absence of 0.5 mM of phloretin or 0.4 mM DIDS (n = 3). B: Intracellular 14C-TG and extracellular 14C-FA under identical experimental conditions except for the presence of 14C-palmitate. The numbers above the black bars indicate the percentage of intracellular radioactivity that appeared in the medium (n = 3). Error bars represent SD.

 
Effects of FA transport inhibitors
For further evidence of a role of FA transporters in these events, we examined the effects of phloretin, a Ca2+ channel inhibitor that also inhibits FA and glucose transport, and DIDS, a cellular anion channel inhibitor that has been shown to inhibit FAT/CD36 (21). Uptake of 14C-palmitate and export of 14C-FA were reduced by 60% and 66%, respectively, by phloretin and by 62% and 75% by DIDS (Fig. 2B). Although both DIDS and phloretin have pleiotropic actions and are not considered specific inhibitors of proteins involved in FA transport, their effects on FA transport could conceivably involve FA transporter proteins. Taken together, these data are consistent with involvement of FAT/CD-36 in FA flux.

To determine if the foregoing results obtained with radiolabeled palmitate are reflected by changes in total TG, we measured the cardiomyocyte TG content biochemically (Fig. 2A). The results were remarkably similar, showing increased TG in etomoxir-treated and insulin-treated cells and a decrease when cells were exposed to phloretin or DIDS.

Time course of FA efflux
To determine the time course of reverse FA transport, we incubated washed cells previously exposed to labeled palmitate in fresh medium for 12 h, and measured the rate of decline in intracellular 14C-TG and the appearance of 14C-FA in the medium. The rate of decline was 6.0%/h (Fig. 3A). Intracellular TG measured biochemically declined by 5.3%/h (Fig. 3B). Neither TG nor glycerol was detected in the extracellular fluid.




View larger version (28K):
[in this window]
[in a new window]
  		Fig. 3. A: Time course of the appearance of 14C-TG in the cardiomyocytes and of the release of 14C-FAs into the culture medium analyzed by TLC. Cardiomyocytes (5 x 105 cells) had been treated with etomoxir and insulin for 12 h. Mean ± standard deviation from the mean. 14C-FA efflux is expressed as % of peak level. Mean % of decline in intracellular 14C-TG measured as % of 0 time represents three similar experiments. B: Decline of intracellular TG measured biochemically (n = 3). Error bars represent SD.

 
FA release in the Langendorff heart perfusion system
To determine if the reverse FA transport demonstrated in vitro also occurs in the intact heart, we used the Langendorff heart perfusion system. At 1 h before hanging the heart, the animals were injected with 5 µmol/100 g of body weight of etomoxir to inhibit FA oxidation. This dose, which was three times that employed by Esser's group (22), elicited a rise in plasma FA concentrations from 465 ± 268 µmol to 1,567 ± 645 µmol, presumably reflecting an overall decrease in FA oxidation. Hearts were then excised and perfused for 60 min and effluent was collected at 10 min intervals.

We compared the total FA released (concentration x flow) during the second 10 min from wild-type and fatty ZDF hearts. This time period was selected because the effluent was unlikely to contain any residual plasma FA that might contaminate perfusate obtained during the first 10 min of perfusion and yet the condition of the heart would still be optimal. As shown in Fig. 4A, in 12 week old lean wild-type ZDF rats on a normal diet, FA release in the second aliquot was 221 ± 59 nmol/10 min; hearts from similar rats on a high-fat diet for 6 weeks released significantly more FA (366 ± 172 nmol/10 min; P < 0.05).





View larger version (43K):
[in this window]
[in a new window]
  		Fig. 4. FFA release from intact hearts in nmol/10 min (concentration x flow) from hearts isolated and perfused for 60 min using the Langendorff perfused heart system. Perfusate was collected at 10 min intervals. FFA concentrations in the second 10 min aliquot were analyzed. A: Wild-type (+/+), lean ZDF on normal (N) or high-fat (H) diets. B: Obese (fa/fa) ZDF rats on a normal diet. Preperfusion TG content was measured in hearts of unperfused, age-matched littermates. *P < 0.05, **P < 0.01. C: FFA release as a function of the baseline TG content of the heart before perfusion in lean, wild-type (+/+) ZDF rats on either a 6% or 60% fat intake and obese (fa/fa) ZDF rats on an ad libitum 6% fat diet. FFA release from perfused heart during a 10 min perfusion period as a function of the TG content based on measurement in unperfused hearts of matched rats. These include mean data points of all experiments (+/+ and fa/fa rats).

 
To determine if the magnitude of outward flux of FA was proportional to the preperfusion myocardial TG content, we measured the mean TG content of unperfused hearts from littermates not selected for perfusion but otherwise identical to the lean and obese rats selected for the perfusion experiments. TG content values are included in Fig. 4A and B. The TG content in unperfused hearts of rats rose on a high-fat diet and was highest after 12 weeks of high-fat feeding. FA release was greater in hearts with a greater TG content (r 2 = 0.86), consistent with the notion that the release of FA into the effluent is related to the magnitude of the lipid excess (Fig. 4C). Neither TG nor glycerol was detected in the effluent.

Despite careful removal of epicardial fat prior to perfusing the hearts, it seemed possible that at least some of the measured TG and the FA appearing in the perfusate might be derived from contaminating adipocytes that had escaped detection. To determine if contamination by intramyocardial adipocytes could account for the intergroup differences in TG content and in FA released into the perfusate, we compared the abundance of mRNA of aP2, an adipocyte-binding protein expressed in adipocytes (23). No significant differences in aP2 mRNA were noted (Fig. 4A).

Obese ZDF rats have a loss-of-function mutation in their leptin receptor (24) and exhibit a high TG content in their hearts (1). Hearts from obese ZDF rats released 257 ± 74 nmol/10 min of FA without pretreatment with etomoxir (Fig. 4B), whereas FA release from the hearts of wild-type lean ZDF rats was undetectable without etomoxir, even after high-fat feeding (Fig. 4A). After etomoxir treatment, FA release in 8 week old obese ZDF rats was 744 ± 260 nmol/10 min and 1,578 ± 630 nmol/10 min in 12 week old obese ZDF rats (P < 0.01). aP2 mRNA was compared in these obese rats; again, no differences were observed (Fig. 4B). Thus, it seems unlikely that differences in FA released by these hearts were derived from contamination by adipocytes.

Effect of insulin on FA release from perfused hearts
To determine the effect of insulin on FA release from the heart, insulin was perfused in the hearts isolated from wild-type ZDF rats on a high-fat diet. Total FA release during 60 min of perfusion rose from 1,618 ± 402 nmol without insulin to 2,135 ± 393 nmol with insulin; postperfusion myocardial TG content decreased from 4.27 ± 0.06 mg/g tissue without insulin to 3.68 ± 0.29 mg/g tissue after treatment with insulin (Fig. 5) (P < 0.05).



View larger version (11K):
[in this window]
[in a new window]
  		Fig. 5. The effect of insulin on FFA release from the hearts of lean, wild-type ZDF rats on a high-fat diet for 6 weeks. Insulin was added after 10 min of perfusion, and the released FFA was analyzed. Error bars represent SD. * P < 0.05.

 
Assessing perfusion-induced myocardial damage
Ex vivo perfusion of an organ ultimately results in damage and death of its cells. To exclude structural damage to the heart tissue during the experimental time frames studied, we measured creatine kinase in the perfusate after Langendorff heart perfusion. Creatine kinase was undetectable. Hearts obtained at the end of the perfusion were also examined electron microscopically and no morphological damage was observed (data not shown). We conclude that cardiomyocytes were uninjured during the time frame of our experiments.


   Discussion
TOP
 ABSTRACT
 INTRODUCTION
 Materials
 Results
 Discussion
REFERENCES
 
FA flux has always been viewed as unidirectional, flowing from adipocytes to nonadipose organs such as heart and skeletal muscle (25). Lipolysis from adipocytes provides a source of fuel for these organs during hypoinsulinemic periods of fasting and/or exercise. Efflux of FA from lean organs to adipocytes and/or liver has never been demonstrated, despite suggestive evidence. In 1969, Most et al. (12) reported that the fractional extraction of labeled FA by the resting human heart was nearly twice that of unlabeled FA, raising the possibility of FA release into the coronary sinus. To our knowledge, no further direct studies were conducted.

Not until Bjorkegren et al. (11) described the phenomenon of lipoprotein secretion by the beating heart was the concept of a nonoxidative pathway for the export of unoxidized FA identified. In view of the importance of intracellular lipid homeostasis to the normal function and survival of nonadipocytes, it is not surprising that vital organs such as the heart would have an auxiliary means of self-protection from lipotoxicity, rather than relying entirely on compensatory FA oxidation to reduce a surplus. We hypothesize that under normal circumstances, as insulin levels rise postprandially, plasma FA levels are lowered both by increased adipocyte import and by antilipolytic action on adipocytes. Our data suggest that plasma FA may also be lowered to some degree by increased uptake by insulin-responsive nonadipose tissue. Outward FA transport stimulated by insulin would occur from nonadipocytes only if FA oxidation were reduced and/or intracellular FA influx had created a FA gradient favoring efflux through translocated FA transporters. Although we could detect no extracellular TG or glycerol in the FA-containing media examined, the possibility that FA was derived from TG efflux cannot be categorically ruled out.

We now recognize that lipid overload may occur in many disorders commonly encountered in clinical medicine, in addition to rare genetic disorders, such as congenital generalized lipodystrophy, congenital leptin deficiency and leptin resistance. Cardiac steatosis occurs most commonly in diet-induced obesity (7) and in hypoxic states (26); reverse FA transport would be expected to be activated in clinical disorders such as these and whenever FA oxidation is decreased or the influx of FA exceeds the oxidative capacity of the organ. It is clear that insulin stimulates glucose utilization and decreases FA utilization by the heart, but the physiologic role of insulin-stimulated FA uptake in isolated cardiomyocytes is at present unclear.

In the present study we examined FA export in vitro and ex vivo. We observed an increase in reverse FA flux whenever FA oxidation was blocked by etomoxir and whenever the TG content of the myocardium was elevated either by overnutrition or by resistance to the antisteatotic action of the liporegulatory hormone, leptin. In both model systems, insulin increased the rate of FA influx and efflux. This is consistent with translocation of a FA transporter, such as the FAT/CD36 (19) to the plasma membrane, after which the direction of FA flux would be determined by the FA gradient. In the presence of insulin, DIDS reduced FA import to 38% of the control and lowered FA export to 25% of the control. These results are consistent with involvement of the Abumrad transporter (19), but more specific inhibitors would be needed to prove this.

Palmitoyl CoA condenses with serine in the first step of de novo ceramide formation. Ceramide is considered to be a major factor in the lipoapoptosis that frequently occurs in lipid-overladen cells (2, 10). Thus, palmitate export may play an important protective role in limiting ceramide-induced lipotoxicity and lipoapoptosis. In the etomoxir-treated rats, in which the oxidative pathway had been closed, the increase in FA release induced by insulin was reflected by a reduction in cardiac TG content, evidence that the export of FA can be quantitatively significant. The data suggest the existence of a previously unsuspected insulin-stimulated efflux system through which surplus FA can be exported when compensatory oxidation is reduced. Its implications in human heart disease remain to be explored.


   ACKNOWLEDGMENTS
 
This study was supported by NIDDK-002700-46, the Department of Veterans Affairs Merit Review, and the Jensen Charitable Lead Trust. The authors thank Dr. Victoria Esser for helping with the cardiomyocyte isolation and Dr. Nada Abumrad for providing reagents and suggestions.

Manuscript received June 18, 2004 and in revised form August 3, 2004. and in re-revised form August 18, 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 Materials
 Results
 Discussion
 REFERENCES
 
  1. Zhou, Y. T., P. Grayburn, A. Karim, M. Shimabukuro, M. Higa, D. Baetens, L. Orci, and R. H. Unger. 2000. Lipotoxic heart disease in obese rats: implications for human obesity. Proc. Natl. Acad. Sci. USA. 97: 1784–1789.[Abstract/Free Full Text]

  2. Chiu, H. C., A. Kovacs, D. A. Ford, F. F. Hsu, R. Garcia, P. Herrero, J. E. Saffitz, and J. E. Schaffer. 2001. A novel mouse model of lipotoxic cardiomyopathy. J. Clin. Invest. 107: 813–822.[Medline]

  3. Lee, Y., H. Hirose, M. Ohneda, J. H. Johnson, J. D. McGarry, and R. H. Unger. 1994. ß-Cell lipotoxicity in the pathogenesis of non-insulin-dependent diabetes mellitus of obese rats: impairment in adipocyte-ß-cell relationships. Proc. Natl. Acad. Sci. USA. 91: 10878–10882.[Abstract/Free Full Text]

  4. Unger, R. H. 2002. Lipotoxic diseases. Annu. Rev. Med. 53: 319–336.[CrossRef][Medline]

  5. Lee, Y., M. Y. Wang, T. Kakuma, Z. W. Wang, E. Babcock, K. McCorkle, M. Higa, Y. T. Zhou, and R. H. Unger. 2001. Liporegulation in diet-induced obesity: the antisteatotic role of hyperleptinemia. J. Biol. Chem. 276: 5629–5635.[Abstract/Free Full Text]

  6. Unger, R. H., and L. Orci. 2001. Diseases of liporegulation: new perspective on obesity and related disorders. FASEB J. 15: 312–321.[Abstract/Free Full Text]

  7. Szczepaniak, L. S., R. L. Dobbins, G. J. Metzger, G. Sartoni-D'Ambrosia, D. Arbique, W. Vongpatanasin, R. Unger, and R. G. Victor. 2003. Myocardial triglycerides and systolic function in humans: in vivo evaluation by localized proton spectroscopy and cardiac imaging. Magn. Reson. Med. 49: 417–423.[CrossRef][Medline]

  8. Listenberger, L. L., X. Han, S. E. Lewis, S. Cases, R. V. Farese, Jr., D. S. Ory, and J. E. Schaffer. 2003. Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc. Natl. Acad. Sci. USA. 100: 3077–3082.[Abstract/Free Full Text]

  9. Shimabukuro, M., M. Higa, Y. T. Zhou, M. Y. Wang, C. B. Newgard, and R. H. Unger. 1998. Lipoapoptosis in ß-cells of obese prediabetic fa/fa rats. Role of serine palmitoyltransferase overexpression. J. Biol. Chem. 273: 32487–32490.[Abstract/Free Full Text]

  10. Shimabukuro, M., K. Koyama, G. Chen, M. Y. Wang, F. Trieu, Y. Lee, C. B. Newgard, and R. H. Unger. 1997. Direct antidiabetic effect of leptin through triglyceride depletion of tissues. Proc. Natl. Acad. Sci. USA. 94: 4637–4641.[Abstract/Free Full Text]

  11. Bjorkegren, J., M. Veniant, S. K. Kim, S. K. Withycombe, P. A. Wood, M. K. Hellerstein, R. A. Neese, and S. G. Young. 2001. Lipoprotein secretion and triglyceride stores in the heart. J. Biol. Chem. 276: 38511–38517.[Abstract/Free Full Text]

  12. Most, A. S., N. Brachfeld, R. Gorlin, and J. Wahren. 1969. Free fatty acid metabolism of the human heart at rest. J. Clin. Invest. 48: 1177–1188.

  13. Lassers, B. W., L. Kaijser, and L. A. Carlson. 1972. Myocardial lipid and carbohydrate metabolism in healthy, fasting men at rest: studies during continuous infusion of 3H-palmitate. Eur. J. Clin. Invest. 2: 348–358.[Medline]

  14. Dagenais, G. R., Y. Marquis, and L. Gailis. 1975. Assessment of myocardial free fatty acid metabolism in humans during heparin infusion. Recent Adv. Stud. Cardiac Struct. Metab. 10: 3–16.[Medline]

  15. Wisneski, J. A., E. W. Gertz, R. A. Neese, and M. Mayr. 1987. Myocardial metabolism of free fatty acids: studies with 14C-labeled substrates in humans. J. Clin. Invest. 79: 359–366.

  16. Little, J. R., M. Goto, and J. J. Spitzer. 1970. Effect of ketones on metabolism of FFA by dog myocardium and skeletal muscle in vivo. Am. J. Physiol. 219: 1458–1463.[Free Full Text]

  17. Evans, J. R., L. H. Opie, and A. E. Renold. 1963. Pyruvate metabolism in the perfused rat heart. Am. J. Physiol. 205: 971–976.[Abstract/Free Full Text]

  18. Korte, K., and M. L. Casey. 1982. Phospholipid and neutral lipid separation by one-dimensional thin-layer chromatography. J. Chromatogr. 232: 47–53.[Medline]

  19. Abumrad, N. A., M. R. el-Maghrabi, E. Z. Amri, E. Lopez, and P. A. Grimaldi. 1993. Cloning of a rat adipocyte membrane protein implicated in binding or transport of long-chain fatty acids that is induced during preadipocyte differentiation: homology with human CD36. J. Biol. Chem. 268: 17665–17668.[Abstract/Free Full Text]

  20. Luiken, J. J., D. P. Koonen, J. Willems, A. Zorzano, C. Becker, Y. Fischer, N. N. Tandon, G. J. Van Der Vusse, A. Bonen, and J. F. Glatz. 2002. Insulin stimulates long-chain fatty acid utilization by rat cardiac myocytes through cellular redistribution of FAT/CD36. Diabetes. 51: 3113–3119.[Abstract/Free Full Text]

  21. Abumrad, N., C. Harmon, and A. Ibrahimi. 1998. Membrane transport of long-chain fatty acids: evidence for a facilitated process. J. Lipid Res. 39: 2309–2318.[Abstract/Free Full Text]

  22. Esser, V., J. Andrews, L. Wang, P. Mack, and D. Foster. 2003. Limited effectiveness of carnitine palmitoyltransferase I inhibitors in vivo and in tissue culture cells (Abstract A317). Diabetes. 52 (Suppl. 1): 1370-P.

  23. Hunt, C. R., J. H. Ro, D. E. Dobson, H. Y. Min, and B. M. Spiegelman. 1986. Adipocyte P2 gene: developmental expression and homology of 5'-flanking sequences among fat cell-specific genes. Proc. Natl. Acad. Sci. USA. 83: 3786–3790.[Abstract/Free Full Text]

  24. Iida, M., T. Murakami, K. Ishida, A. Mizuno, M. Kuwajima, and K. Shima. 1996. Phenotype-linked amino acid alteration in leptin receptor cDNA from Zucker fatty (fa/fa) rat. Biochem. Biophys. Res. Commun. 222: 19–26.[CrossRef][Medline]

  25. Dole, V. P. 1956. A relation between non-esterified fatty acids in plasma and the metabolism of glucose. J. Clin. Invest. 35: 150–154.

  26. Wayman, N. S., Y. Hattori, M. C. McDonald, H. Mota-Filipe, S. Cuzzocrea, B. Pisano, P. K. Chatterjee, and C. Thiemermann. 2002. Ligands of the peroxisome proliferator-activated receptors (PPAR-{gamma} and PPAR-{alpha}) reduce myocardial infarct size. FASEB J. 16: 1027–1040.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
K. R. Wildsmith, C. J. Albert, D. S. Anbukumar, and D. A. Ford
Metabolism of Myeloperoxidase-derived 2-Chlorohexadecanal
J. Biol. Chem., June 23, 2006; 281(25): 16849 - 16860.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M400237-JLR200v1
45/11/1992    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, B.-H.
Right arrow Articles by Unger, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, B.-H.
Right arrow Articles by Unger, R. H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Molecular and Cellular Proteomics   ASBMB Today