|
Originally published In Press as doi:10.1194/jlr.M500157-JLR200 on September 16, 2005
Journal of Lipid Research, Vol. 46, 2570-2579, December 2005
Copyright © 2005 by American Society for Biochemistry and Molecular Biology
Identification and characterization of two alternatively spliced transcript variants of human liver X receptor alpha
Mingyi Chen*,
Simon Beaven and
Peter Tontonoz1,*,
* Department of Pathology and Laboratory Medicine, University of California, Los Angeles, CA 90095
Division of Digestive Diseases, Department of Medicine, University of California, Los Angeles, CA 90095
Howard Hughes Medical Institute, University of California, Los Angeles, CA 90095
Published, JLR Papers in Press, September 16, 2005. DOI 10.1194/jlr.M500157-JLR200
1 To whom correspondence should be addressed. e-mail: ptontonoz{at}mednet.ucla.edu
 |
ABSTRACT
|
|---|
The liver X receptor (LXR ) is a member of the nuclear hormone receptor superfamily that plays an important role in lipid homeostasis. Here we characterize two alternative human LXR transcripts, designated LXR 2 and LXR 3. All three LXR isoforms are derived from the same gene via alternative splicing and differential promoter usage. The LXR 2 isoform lacks the first 45 amino acids of LXR 1, and is generated through the use of a novel promoter and first exon. LXR 3 lacks 50 amino acids within the ligand binding domain and is generated through alternative recognition of the 3'-splice site in exon 6. LXR 2 and LXR 3 are expressed at lower levels compared with LXR 1 in most tissues, except that LXR 2 expression is dominant in testis. Both LXR 2 and LXR 3 heterodimerize with the retinoid X receptor and bind to LXR response elements. LXR 2 shows reduced transcriptional activity relative to LXR 1, indicating that the N-terminal domain of LXR is essential for its full transcriptional activity. LXR 3 is unable to bind ligand and is transcriptionally inactive.
These observations outline a previously unrecognized role for the N terminus in LXR function and suggest that the expression of alternative LXR transcripts in certain biological contexts may impact LXR signaling and lipid metabolism.
Abbreviations: AF, activation function; DBD, DNA binding domain; LBD, ligand binding domain; LXR, liver X receptor; LXRE, LXR response element; RXR, retinoid X receptor Supplementary key words nuclear receptor cholesterol metabolism transcriptional regulation RXR
 |
INTRODUCTION
|
|---|
Nuclear hormone receptors are transcription factors that are involved in numerous biological processes, including reproduction, development, and metabolism (1). Most of these receptors are comprised of a ligand-independent transcriptional activation function (AF1) domain at the N terminus, a DNA binding domain (DBD), a hinge region, and a ligand binding domain (LBD). The LBD possesses a dimerization interface, and a ligand-dependent activation function (AF2) region at the carboxyl terminus (2). The transcriptional activity of most nuclear hormone receptors is stimulated by specific small-molecule ligands. Binding of ligand to the LBD results in a conformational change of the receptor, release of corepressors, recruitment of coactivators, and transcriptional activation (3, 4).
The liver X receptors (LXRs) are nuclear hormone receptors that play a key role in the regulation of lipoprotein metabolism (5, 6). LXRs are activated by oxidized derivatives of cholesterol that serve as ligands (79). Two different LXRs have been described, LXR (NR1H3) and LXRß (NR1H2). LXR is expressed at high levels in liver, adipose tissue, macrophages, intestine, kidney, and spleen, whereas LXRß is expressed ubiquitously (9). Both LXRs heterodimerize with the retinoid X receptor (RXR) and stimulate transcription through binding to DR-4 response elements in target gene promoters (10).
To date, more than a dozen LXR target genes have been identified. They are involved in hepatic bile acid and fatty acid synthesis, glucose metabolism, and sterol efflux (1116). In the liver, LXRs regulate gene expression of CYP7A (17) and sterol-regulatory binding element protein 1c (18), which are involved in cholesterol and fatty acid metabolism. In macrophages and other peripheral cell types, LXRs control the transcription of several genes involved in cellular cholesterol efflux, including ATP binding cassette transporter A1 (ABCA1) (19, 20), ABCG1 (21), and apolipoprotein E (14). LXRs also influence lipoprotein metabolism through the control of modifying enzymes such as lipoprotein lipase (22), cholesteryl ester transfer protein (11), and phospholipid transfer protein (13). Ligands for LXR have been shown to inhibit intestinal cholesterol absorption, promote hepatic sterol excretion, and reduce atherosclerosis in murine models (18, 2325).
Multiple isoforms have been identified for many members of the nuclear hormone receptor family. In several cases, different receptor isoforms have been found to have distinct activities and to play distinct biological roles (2, 26). Here we describe the identification and characterization of two isoforms of human LXR that have distinct expression patterns and altered transcriptional activity.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Reagents and plasmids
GW3965 and T0901317 were provided by T. Willson and J. Collins at GlaxoSmithKline. Ligands were dissolved in DMSO prior to use in cell culture. The full-length coding regions of human LXR isoforms were amplified by PCR using specific primers and subcloned into BamHI/XhoI sites of the mammalian expression vector pCMX-PL1, to create pCMX-LXR 1, pCMX-LXR 2, and pCMX-LXR 3, respectively. Three isoforms of human LXR were also subcloned into pEGFP-C1 vector using XhoI/BamHI sites to allow expression of N-terminal GFP-hLXR fusion proteins. For retroviral expression constructs, inserts were excised from the pEGFP vectors using BglII/XhoI restriction enzymes and subcloned into BamHI/SalI sites of the pBabe vector to generate pBABE-GFP and pBABE-GFP-LXR 1, -LXR 2, and -LXR 3. The isoforms were also cloned into pShuttle-1 vector, which includes three repeats of FLAG tag in the N terminus. The dominant negative ( AF2) of human LXR was generated by cloning of amino acids 1435 of hLXR 1 to pCMV-Tag3C (Stratagene) vector via BamHI/XhoI sites. All plasmids were confirmed by DNA sequencing.
Cell culture, transfection, and reporter gene assays
HepG2 and HEK-293 cells were cultured in modified Eagle's medium containing 10% fetal bovine serum or lipoprotein-deficient fetal bovine serum (LPDS). Transient transfections were performed in triplicate in 48-well plates. Cells were transfected with reporter plasmid (100 ng/well), receptor plasmids (550 ng/well), pCMV-ß-galactosidase (50 ng/well), and pTKCIII (to a total of 205 ng/well) using Lipofectamine 2000 reagent (Invitrogen). Following transfection, cells were incubated in modified Eagle's medium containing 10% LPDS and the indicated ligands or vehicle control for 24 h, and the results (mean ± SE; three experiments) were determined. Luciferase activities were assayed and normalized to ß-galactosidase activity.
Quantitative PCR
Real-time quantitative PCR assays were performed using an Applied Biosystems 7700 sequence detector. Total RNA was reverse transcribed with random hexamers by using TaqMan reverse-transcription reagents (Applied Biosystems) according to the manufacturer's protocol. Real-time PCR Sybergreen assays for LXR transcript levels were performed essentially as described (15). Samples were analyzed simultaneously for 36B4 expression. Quantitative expression values were extrapolated from separate standard curves. Each sample was assayed in duplicate and normalized to 36B4. The sequences for primers are as follows: hLXR 1, 5'3' (forward primer, CTGTGCCTGACATTCCTCCTG), 5'3' (reverse primer, CTGGCTGCTTGCATCCTGT); hLXR 2, 5'3' (forward primer, TGGCGGAGGAGCATAAGAAG), 5'3' (reverse primer, CTGGCTGCTTGCATCCTGT); hLXR 3, 5'3' (forward primer, GACCGGCTTCGAGTCACGGTGA), 5'3' (reverse primer, CACTCCCAGGGTTGTACCTCC).
Gel shift assays
Human LXR isoforms and human RXR were synthesized in vitro using the TNT T7-coupled reticulocyte system (Promega). To compare transcription/translation efficiency of the expression constructs expressing different human LXR isoforms, equal volumes of 35S-labeled lysates were loaded and separated on an 8% SDS-polyacrylamide gel. Gel shift assays were performed as described (15) using in vitro-translated proteins. Binding reactions were carried out in a buffer containing 10 mM HEPES, pH 7.8, 100 mM KCl, 0.2% Nonidet P-40, 6% glycerol, 0.3 mg/ml BSA, 1 mM dithiothreitol, 2 µg of poly(dI-dC), 13 µl each of in vitro-translated receptors and 32P end-labeled oligonucleotide. DNA-protein complexes were resolved on a 5% polyacrylamide gel. The sequence of the rat FAS LXRE oligonucleotide was (only one strand shown): 5'-gatcacgatgaccggtagtaaccccgcc-3'.
Fluorescence microscopy
Cells were transfected with retroviral vectors pBABE-GFP, pBABE-GFPLXR 1, pBABE-GFPLXR 2, and pBABE-GFPLXR 3, and selected with puromycin to generate stable cell lines. The cells were seeded in 4-well chamber slides and fixed in 4% paraformaldehyde for 10 min at room temperature. Slides were mounted in Vectashield medium for fluorescence with 4',6-diamidino-2-phenylindole (Vector) and analyzed under a Zeiss fluorescence microscope.
Western blot analysis
Cells transiently or stably transfected with FLAG-LXR constructs were lysed in radioimmunoprecipitation assay buffer. Supernatants were collected, and protein content was assayed using the Bio-Rad protein reagent. Samples containing equal amounts of protein were boiled in 250 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, and 2% mercaptoethanol, and then size-separated in 8% SDS-PAGE. Proteins were transferred to nitrocellulose membrane. Protein expression was detected with HRP-anti-FLAG antibody (M2) from Sigma, and visualized by the ECL technique.
 |
RESULTS
|
|---|
By searching the expressed sequence tag (EST) database, we identified two cDNA clones similar to human LXR (BC041172 and BC008819). Primers based on the EST sequences were used to amplify these LXR transcripts from cDNA, and the products were subcloned and sequenced. Comparison of these sequences to the publicly available genomic sequence of human chromosome 11 (www.genome.ucsc.edu) revealed that these two new LXR transcripts were generated by alternative RNA splicing. For clarity, we refer to the original isoform as LXR 1 and the two new isoforms as LXR 2 and LXR 3, respectively. Details of the genomic organization of the human LXR gene and the origin of various LXR transcripts are shown in Fig. 1A
. Our data indicate that the gene encompasses more than 20 kbp and contains 12 potential exons. Three distinct LXR transcripts are produced through alternative splicing and promoter usage. The original isoform, LXR 1, and the newly identified LXR 3 are transcribed from a promoter upstream of exons 1a and 1b (15). The LXR 2 mRNA is transcribed from an alternative promoter and exon 1c, located approximately 10 kb upstream of exon 1a. Figure 1B shows an alignment of the predicted amino acid sequences of the three LXR isoforms. The LXR 1 protein has 447 amino acids with a predicted size of 50.4 kDa. Because exons 1a and 1b are noncoding, the choice of these exons does not impact protein sequence. By contrast, translation of the LXR 2 mRNA starts in exon 3, leading to a truncated protein lacking the N-terminal 45 amino acids of LXR 1. The LXR 3 mRNA is generated by the removal of exon 6 through alternative splicing, leading to an in-frame deletion of 50 amino acids from the LBD.
To determine the absolute level of expression of LXR isoforms in different tissues, total RNA from 20 human tissues was reverse transcribed and real-time quantitative PCR was performed. As shown in Fig. 2A
, the various LXR isoforms differ in their patterns of expression. In normal tissues, the highest hLXR 1 expression was detected in liver, heart, brain, spleen, and kidney. LXR 2 was highly expressed in testis, where it was the predominant isoform. LXR 3 was expressed at relatively lower levels in lung, thyroid gland, and spleen. In addition to normal tissues, transformed cell lines representing lymphoma, melanoma, osteosarcoma, meduloblastoma, and glioma were analyzed (Fig. 2B). Interestingly, the alternative isoforms 2 and 3 were somewhat more highly expressed in tumor cells compared with normal tissues. Furthermore, the cell type-specific nature of alternative transcript expression was also evident from these samples.
To investigate whether the alternative LXR 2 and - 3 proteins were competent to bind DNA, they were produced in vitro using reticulocyte lysates. In vitro transcription/translation experiments confirmed the production of LXR 1, LXR 2, and LXR 3 proteins with expected molecular weights (Fig. 3A)
. Electrophoretic mobility shift assays revealed that both LXR 2 and LXR 3 retain the ability to heterodimerize with RXR and to bind the LXR response element (LXRE) from the fatty acid synthase (FAS) gene (12) (Fig. 3B). To address the transcriptional activity of the LXR 2 and LXR 3 isoforms, we performed transient transfections into HEK-293 cells. As expected, transfection of an LXR 1 cDNA expression vector stimulated activity of an LXRE-driven luciferase reporter in a ligand (T1317, 1 µM)-dependent manner (Fig. 3C). A low level of basal activity was observed with the LXRE reporter in the absence of transfected LXR due to the expression of endogenous LXRß in HEK-293 cells. Transfection of an expression vector encoding the LXR 2 cDNA also promoted LXRE reporter expression, but it was clearly less active than LXR 1. By contrast, expression of LXR 3 cDNA did not stimulate reporter expression above basal levels. As a result of the deletion of the 50 amino acids encoded by exon 6, the LXR 3 protein lacks helixes 3 and 4 and part of helix 5, which comprise the ligand binding pocket of LXR 1 (27). On the basis of this structure, and consistent with our results in transient transfection assays, LXR 3 is predicted to be unable to bind ligand (T. Willson, personal communication). The results shown in Fig. 3 demonstrate that although both LXR 2 and LXR 3 bind DNA, they show altered transcriptional activity compared with LXR 1. Similar differences in activity between isoforms were observed when the natural LXR agonist 22(R)-hydroxycholesterol or the synthetic ligand GW3965 was used in place of T1317 (data not shown).
Presently, reliable antibodies recognizing the different human LXR isoforms are not available. We therefore utilized GFP fusion proteins to study expression of the LXR protein isoforms. We utilized retroviral transduction to generate HEK-293 cell lines expressing GFP-LXR 1, GFP-LXR 2, and GFP-LXR 3 fusion proteins. The cellular localization of the LXR 1, LXR 2, and LXR 3 proteins was visualized by fluorescence microscopy. Expression of the GFP-LXR 1 fusion protein in HEK-293 cells led to an exclusively nuclear distribution of fluorescence (Fig. 4A)
. Identical cellular localization was observed with GFP-LXR 2 and GFP-LXR 3 fusion proteins. Furthermore, the alternative LXR cDNAs were expressed and translated at rates comparable to those of LXR 1. An equivalent amount of fusion protein was produced by the three expression vectors, as judged by fluorescence microscopy (Fig. 4A) and Western blotting, using an anti-GFP antibody (data not shown). When the activity of the three GFP-LXR fusion proteins was compared in transient transfection assays, the results were similar to those obtained with native LXR isoform expression vectors. GFP-LXR 2 showed reduced activity compared with GFP-LXR 1, and GFP-LXR 3 was inactive (Fig. 4B).
To determine whether the various LXR isoforms also showed differential activity on endogenous target genes, we analyzed ABCA1 expression in HEK-293 cells transduced with retroviral GFP-LXR fusion vectors. As shown in Fig. 4C, expression of LXR 1 strongly stimulated expression of ABCA1 mRNA. Consistent with their behavior in transient transfection assays, LXR 2 showed reduced activity, whereas LXR 3 actually reduced ABCA1 expression. Thus, LXR 2 and LXR 3 display altered transcriptional activity on the endogenous ABCA1 promoter as well as in transient transfection reporter assays.
The reduced activity of LXR 2 compared with LXR 1 suggests an unexpected function for the LXR N terminus in transcriptional regulation. Studies on other nuclear receptors have shown that the N terminus can function to augment (e.g., RXR , Ref. 28 and estrogen receptor, Ref. 29) or inhibit (e.g., PPAR ) transcriptional activity (30). However, the ability of the N terminus of LXR to contribute to overall receptor activity has not been explored previously. To address the role of the LXR N terminus in more detail, we constructed serial deletions. As shown in Fig. 5
, transfection of the deletion constructs into HEK-293 cells revealed that the N-terminal 20 amino acids are required for full receptor activity. Furthermore, activity declined further with the deletion of the N-terminal 45 amino acids. This observation suggests that sequences between amino acids 5 and 45 are important for receptor function. Similar results were obtained when GW3965 or T1317 was used as the LXR ligand (data not shown).
To ensure that the GFP fusion itself was not influencing the activity of the various LXR isoforms, we also explored the function of LXR 2 and LXR 3 using FLAG-tagged LXR fusion proteins. Transfection of these expression vectors into HEK-293 cells produced equivalent levels of LXR protein, as determined by Western blotting using an anti-FLAG antibody (Fig. 6A)
. Consistent with the results presented above, FLAG-LXR 2 showed reduced activity compared with FLAG-LXR 1, whereas FLAG-LXR 3 was inactive (Fig. 6B). Furthermore, a FLAG-tagged receptor containing two repeats of the N-terminal 74 amino acids showed increased activity compared with the wild-type LXR 1 (Fig. 6B). Finally, the isolated AF1 domain enhanced the transcription of a GAL4-luciferase reporter when it was fused with GAL4 DBD (Fig. 6C). Thus, the N terminus of LXR contains a bona fide transcriptional activation function.
The observation that LXR 3 binds DNA but is unable to activate transcription suggests that it might act to antagonize the function of wild-type LXR 1 when expressed in the same cell. Because mutations in the LBDs of other nuclear receptors have been shown to give rise to dominant-negative receptors, we considered the possibility that LXR 3 might function as a dominant negative. However, the effect of expression of LXR 3 in transfection assays was distinct from that of an AF2 deletion mutant ( AF2) that we have previously shown to function as a dominant negative (20). Expression of the AF2 mutant effectively blocked basal LXR in the transfected cells, whereas that of LXR 3 did not (Fig. 7A)
. Moreover, when expressed together with LXR 1 in transfection assays, LXR 3 was able to function as a competitive inhibitor, but not a dominant-negative inhibitor, of LXR 1 (Fig. 7B). Expression of a large molar excess of LXR 3 was required to inhibit the function of LXR 1. Similar results were obtained when GW3965 or T1317 was used as the LXR ligand (data not shown). This observation is consistent with LXR 3 forming inactive heterodimers with RXR and simply competing for LXR 1 on the target promoter.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7. hLXR 3 does not function as a dominant-negative receptor (A and B). HepG2 cells were transiently cotransfected with pTk3xLXRE-Luc and plasmids encoding RXR, LXR 1, LXR 2, LXR 3, or AF2. The amount (ng) of each plasmid used in the transfection is shown as LXR 1, LXR 2, and LXR 3 (20, 40, and 80 ng, respectively). Cells were treated with vehicle or LXR ligand (GW3965, 1 µM) for 24 h. The results (mean ± SE; three experiments) are presented as luciferase activity normalized to ß-galactosidase (Gal) activity. * P < 0.05 versus LXR 1 by Student's t-test (2-tailed).
|
|
 |
DISCUSSION
|
|---|
The LXRs are oxysterol-activated nuclear hormone receptors that regulate the expression of genes involved in cholesterol and fatty acid metabolism (5, 6). In previous studies, the human LXR gene was mapped to chromosome 11 at 11p11.2. It was shown to cover 10.82 kb of genome sequence and to contain 11 exons (10). The present study expands our knowledge of the LXR genomic locus. We show that the locus spans more than 20 kb of sequence and contains 12 possible exons. By searching the EST database, we have identified two new isoforms of human LXR , termed hLXR 2 and hLXR 3. These two new LXR transcripts are generated by alternative splicing and alternate promoter usage and exhibit altered transcriptional activity relative to LXR 1. These results add additional complexity to the known mechanisms of transcriptional regulation of lipid metabolism by LXRs.
In this study, a new upstream exon of the human LXR gene was identified that is incorporated into the LXR 2 isoform. LXR 2 varies from LXR 1 in its 5' untranslated region as a result of the use of this alternative first exon (termed 1c), which is nearly 10 kb upstream of the previously identified first exons 1a and 1b. Thus, initiation of transcription of the LXR gene from alternative promoters upstream of exons 1c or 1 a/b results in the expression of multiple LXR transcripts. The mRNAs transcribed from these two promoters encode LXR protein isoforms that vary in the length of their N-terminal domains. Human LXR 2 lacks the N-terminal 45 amino acids of LXR 1, which comprise a large part of the AF1 domain. The LXR 3 mRNA is generated by the removal of exon 6 through alternative splicing, leading to an in-frame deletion of 50 amino acids from the LBD of LXR 1. Although we have not yet conducted a detailed analysis, preliminary observations suggest that multiple LXR isoforms also exist in the mouse.
The three LXR isoforms are differentially expressed in various human tissues. hLXR 2 is expressed at lower levels compared with hLXR 1 in many tissues, including liver, heart, kidney, and brain. In testis, however, hLXR 2 is the predominant isoform. The expression of the exon 1c transcript of hLXR 2 in a tissue-specific manner may reflect a requirement for tissue- or cell-specific protein factors to mediate expression from this promoter. hLXR 3 is expressed at a low level in most human tissues but at higher levels in tumor cells. Thus, the alternative splicing that generates hLXR 3 appears to occur with higher frequency in tumor cells. The significance of this observation remains to be explored. The possibility remains that LXR 2 and LXR 3 may be expressed at higher levels in cell types not examined here or may be induced in response to specific stimuli or metabolic conditions. Interestingly, the tissue-specific expression of LXR isoforms is very similar to the expression of analogous isoforms of its heterodimeric partner, RXR . Isoforms of RXR also differ in their N-terminal region (28). The major isoform, RXR 1, is widely expressed in embryos and adults, whereas RXR 2 and - 3 are restricted to the adult testis.
We also characterized the function of these two novel isoforms of LXR . Both LXR 2 and LXR 3 retain the ability to heterodimerize with RXR and bind to DR-4-type LXREs. However, LXR 2 exhibits reduced transcriptional activity compared with LXR 1, both in transient transfection assays and in its effects on endogenous target gene expression. This surprising observation led us to further explore the role of the LXR N terminus in transcriptional activation. Using a series of N-terminal deletions, we found that the amino acids between 5 and 45 are essential for the full transcriptional activity of human LXR . Furthermore, the isolated N terminus of LXR 1 was able to activate transcription when fused to a GAL4 DBD, indicating that it contains a bona fide transcriptional activation function. In contrast to LXR 2, the LXR 3 protein appears to encode a receptor that cannot bind ligand and is transcriptionally inactive. It is generated by transcriptional initiation from exon 1b and alternative splicing of exon 6. Molecular modeling predicts that removal of 50 amino acids in LXR 3 would not change the RXR dimerization interface but would lead to the collapse of the ligand binding pocket (T. Willson, personal communication). Consistent with its predicted structure, LXR 3 was capable of interacting with LXREs but did not respond to ligand in transactivation assays. When coexpressed with LXR 1, LXR 3 functions as a competitive antagonist but not a dominant-negative inhibitor. This observation suggests that LXR 3 may not be able to bind either coactivators or corepressors.
The N-terminal (AF1 domain or A/B region) of nuclear receptors is the least-conserved domain across the family, varying considerably both in length and in sequence (2, 26, 31). Furthermore, heterogeneity in the N-terminal region is a common feature of many nuclear receptors. Several receptors have functionally distinct isoforms arising from differential promoter usage and/or alternative splicing. For example, tissue-specific alternative-promoter usage generates multiple transcripts of PPAR (32), PPAR (33), CAR (34), RAR (35), RXR (36), estrogen receptor (ER) (37), glucocorticoid receptor (GR) (38), and others. In addition, the activity of the AF1 domain has been shown to vary in both a tissue- and promoter-specific manner for several nuclear receptors (2). We have shown here that LXR , like several other members of the nuclear receptor superfamily, contains a ligand-independent activation domain in its N-terminal AF1 domain. The AF1 activities of other nuclear receptors serve significant functions in transcriptional regulation, not only by providing ligand-independent activation, but also by synergizing with AF2 (28, 29, 31, 39, 40). Interaction of AF1 regions with transcriptional coactivators has also been reported for several receptors (4, 29, 3941). Other studies have suggested that the N-terminal domain can influence ligand binding (30). It is possible that truncation of the AF1 domain in human LXR 2 alters coactivator recruitment. It is also possible that LXR undergoes posttranslational modification in the AF1 domain. For example, its partner receptor, RXR, can be phosphorylated at several serine and threonine residues in its N-terminal domain (42). Sequence analysis reveals several predicted phosphorylation and sumoylation sites that are conserved with LXR proteins in other species (unpublished observations). Loss of these posttranscriptional modifications in LXR 2 may alter receptor function. The identification of interaction partners of the AF1 domain, the analysis of posttranslational modifications in the AF1 domain, and the examination of possible intramolecular communication involving the AF1 domain of LXR are important subjects for future studies.
The observation that LXR 2 is the predominant isoform expressed in testis provides an interesting avenue for future investigation. Alternative splicing in the testes is important for sex determination, meiotic gene regulation, and spermatogenesis. A network of testes-specific splicing factor interactions has been uncovered (43). During male meiosis, there is a switch from active to inactive or from inactive to active transcription factors, directed by alternative splicing. Therefore, the differential expression of human LXR isoforms in testis may play a role in the differential transcriptional regulation of LXR target genes. The implications of alternative LXR isoform expression for LXR-dependent gene expression and lipid homeostasis in various cell types in vivo remain to be explored.
 |
ACKNOWLEDGMENTS
|
|---|
The authors are grateful to Dr. Mathew Kennedy for sharing the human tissue RNAs. In addition, the authors thank Brenda Mueller for administrative support. This work was supported by a postdoctoral fellowship from the American Heart Association (M.C.). P.T. is an Investigator of the Howard Hughes Medical Institute at the University of California, Los Angeles. This work was supported by National Institutes of Health Grants HL-66088 and HL-30568.
Submitted on
April 22, 2005
Revised on
July 19, 2005 and in re-revised form September 2, 2005
 |
REFERENCES
|
|---|
- Chawla, A., J. J. Repa, R. M. Evans, and D. J. Mangelsdorf. 2001. Nuclear receptors and lipid physiology: opening the X-files. Science. 294: 18661870.[Abstract/Free Full Text]
- Robinson-Rechavi, M., H. Escriva Garcia, and V. Laudet. 2003. The nuclear receptor superfamily. J. Cell Sci. 116: 585586.[Free Full Text]
- Kliewer, S. A., J. M. Lehmann, and T. M. Willson. 1999. Orphan nuclear receptors: shifting endocrinology into reverse. Science. 284: 757760.[Abstract/Free Full Text]
- Xu, L., C. K. Glass, and M. G. Rosenfeld. 1999. Coactivator and corepressor complexes in nuclear receptor function. Curr. Opin. Genet. Dev. 9: 140147.[CrossRef][Medline]
- Repa, J. J., and D. J. Mangelsdorf. 2000. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu. Rev. Cell Dev. Biol. 16: 459481.[CrossRef][Medline]
- Tontonoz, P., and D. J. Mangelsdorf. 2003. Liver X receptor signaling pathways in cardiovascular disease. Mol. Endocrinol. 17: 985993.[Abstract/Free Full Text]
- Lehmann, J. M., S. A. Kliewer, L. B. Moore, T. A. Smith-Oliver, B. B. Oliver, J. L. Su, S. S. Sundseth, D. A. Winegar, D. E. Blanchard, T. A. Spencer, et al. 1997. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem. 272: 31373140.[Abstract/Free Full Text]
- Janowski, B. A., P. J. Willy, T. R. Devi, J. R. Falck, and D. J. Mangelsdorf. 1996. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature. 383: 728731.[CrossRef][Medline]
- Peet, D. J., B. A. Janowski, and D. J. Mangelsdorf. 1998. The LXRs: a new class of oxysterol receptors. Curr. Opin. Genet. Dev. 8: 571575.[CrossRef][Medline]
- Willy, P. J., K. Umesono, E. S. Ong, R. M. Evans, R. A. Heyman, and D. J. Mangelsdorf. 1995. LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev. 9: 10331045.[Abstract/Free Full Text]
- Luo, Y., and A. R. Tall. 2000. Sterol upregulation of human CETP expression in vitro and in transgenic mice by an LXR element. J. Clin. Invest. 105: 513520.[Medline]
- Joseph, S. B., B. A. Laffitte, P. H. Patel, M. A. Watson, K. E. Matsukuma, R. Walczak, J. L. Collins, T. F. Osborne, and P. Tontonoz. 2002. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J. Biol. Chem. 277: 1101911025.[Abstract/Free Full Text]
- Laffitte, B. A., S. B. Joseph, M. Chen, A. Castrillo, J. Repa, D. Wilpitz, D. Mangelsdorf, and P. Tontonoz. 2003. The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol. Cell. Biol. 23: 21822191.[Abstract/Free Full Text]
- Laffitte, B. A., J. J. Repa, S. B. Joseph, D. C. Wilpitz, H. R. Kast, D. J. Mangelsdorf, and P. Tontonoz. 2001. LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc. Natl. Acad. Sci. USA. 98: 507512.[Abstract/Free Full Text]
- Laffitte, B. A., S. B. Joseph, R. Walczak, L. Pei, D. C. Wilpitz, J. L. Collins, and P. Tontonoz. 2001. Autoregulation of the human liver X receptor alpha promoter. Mol. Cell. Biol. 21: 75587568.[Abstract/Free Full Text]
- Laffitte, B. A., L. C. Chao, J. Li, R. Walczak, S. Hummasti, S. B. Joseph, A. Castrillo, D. C. Wilpitz, D. J. Mangelsdorf, J. L. Collins, et al. 2003. Activation of liver X receptor improves glucose tolerance through coordinate regulation of glucose metabolism in liver and adipose tissue. Proc. Natl. Acad. Sci. USA. 100: 54195424.[Abstract/Free Full Text]
- Peet, D. J., S. D. Turley, W. Ma, B. A. Janowski, J. M. Lobaccaro, R. E. Hammer, and D. J. Mangelsdorf. 1998. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell. 93: 693704.[CrossRef][Medline]
- Repa, J. J., G. Liang, J. Ou, Y. Bashmakov, J. M. Lobaccaro, I. Shimomura, B. Shan, M. S. Brown, J. L. Goldstein, and D. J. Mangelsdorf. 2000. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev. 14: 28192830.[Abstract/Free Full Text]
- Chawla, A., W. A. Boisvert, C. H. Lee, B. A. Laffitte, Y. Barak, S. B. Joseph, D. Liao, L. Nagy, P. A. Edwards, L. K. Curtiss, et al. 2001. A PPAR gamma-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol. Cell. 7: 161171.[CrossRef][Medline]
- Venkateswaran, A., B. A. Laffitte, S. B. Joseph, P. A. Mak, D. C. Wilpitz, P. A. Edwards, and P. Tontonoz. 2000. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc. Natl. Acad. Sci. USA. 97: 1209712102.[Abstract/Free Full Text]
- Venkateswaran, A., J. J. Repa, J. M. Lobaccaro, A. Bronson, D. J. Mangelsdorf, and P. A. Edwards. 2000. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols. J. Biol. Chem. 275: 1470014707.[Abstract/Free Full Text]
- Zhang, Y., J. J. Repa, K. Gauthier, and D. J. Mangelsdorf. 2001. Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta. J. Biol. Chem. 276: 4301843024.[Abstract/Free Full Text]
- Yu, L., J. York, K. von Bergmann, D. Lutjohann, J. C. Cohen, and H. H. Hobbs. 2003. Stimulation of cholesterol excretion by the liver X receptor agonist requires ATP-binding cassette transporters G5 and G8. J. Biol. Chem. 278: 1556515570.[Abstract/Free Full Text]
- Repa, J. J., K. E. Berge, C. Pomajzl, J. A. Richardson, H. Hobbs, and D. J. Mangelsdorf. 2002. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J. Biol. Chem. 277: 1879318800.[Abstract/Free Full Text]
- Joseph, S. B., E. McKilligin, L. Pei, M. A. Watson, A. R. Collins, B. A. Laffitte, M. Chen, G. Noh, J. Goodman, G. N. Hagger, et al. 2002. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. USA. 99: 76047609.[Abstract/Free Full Text]
- Ruau, D., J. Duarte, T. Ourjdal, G. Perriere, V. Laudet, and M. Robinson-Rechavi. 2004. Update of NUREBASE: nuclear hormone receptor functional genomics. Nucleic Acids Res. 32: D165D167.[Abstract/Free Full Text]
- Svensson, S., T. Ostberg, M. Jacobsson, C. Norstrom, K. Stefansson, D. Hallen, I. C. Johansson, K. Zachrisson, D. Ogg, and L. Jendeberg. 2003. Crystal structure of the heterodimeric complex of LXRalpha and RXRbeta ligand-binding domains in a fully agonistic conformation. EMBO J. 22: 46254633.[CrossRef][Medline]
- Mascrez, B., M. Mark, W. Krezel, V. Dupe, M. LeMeur, N. B. Ghyselinck, and P. Chambon. 2001. Differential contributions of AF-1 and AF-2 activities to the developmental functions of RXR alpha. Development. 128: 20492062.[Abstract/Free Full Text]
- Metivier, R., G. Penot, G. Flouriot, and F. Pakdel. 2001. Synergism between ERalpha transactivation function 1 (AF-1) and AF-2 mediated by steroid receptor coactivator protein-1: requirement for the AF-1 alpha-helical core and for a direct interaction between the N- and C-terminal domains. Mol. Endocrinol. 15: 19531970.[Abstract/Free Full Text]
- Shao, D., S. M. Rangwala, S. T. Bailey, S. L. Krakow, M. J. Reginato, and M. A. Lazar. 1998. Interdomain communication regulating ligand binding by PPAR-gamma. Nature. 396: 377380.[CrossRef][Medline]
- Dowhan, D. H., and G. E. Muscat. 1996. Characterization of the AB (AF-1) region in the muscle-specific retinoid X receptor-gamma: evidence that the AF-1 region functions in a cell-specific manner. Nucleic Acids Res. 24: 264271.[Abstract/Free Full Text]
- Yu, S., K. Matsusue, P. Kashireddy, W. Q. Cao, V. Yeldandi, A. V. Yeldandi, M. S. Rao, F. J. Gonzalez, and J. K. Reddy. 2003. Adipocyte-specific gene expression and adipogenic steatosis in the mouse liver due to peroxisome proliferator-activated receptor gamma1 (PPARgamma1) overexpression. J. Biol. Chem. 278: 498505.[Abstract/Free Full Text]
- Chew, C. H., M. R. Samian, N. Najimudin, and T. S. Tengku-Muhammad. 2003. Molecular characterisation of six alternatively spliced variants and a novel promoter in human peroxisome proliferator-activated receptor alpha. Biochem. Biophys. Res. Commun. 305: 235243.[CrossRef][Medline]
- Auerbach, S. S., R. Ramsden, M. A. Stoner, C. Verlinde, C. Hassett, and C. J. Omiecinski. 2003. Alternatively spliced isoforms of the human constitutive androstane receptor. Nucleic Acids Res. 31: 31943207.[Abstract/Free Full Text]
- Parrado, A., G. Despouy, R. Kraiba, C. Le Pogam, S. Dupas, M. Choquette, M. Robledo, J. Larghero, H. Bui, I. Le Gall, et al. 2001. Retinoic acid receptor alpha1 variants, RARalpha1DeltaB and RARalpha1DeltaBC, define a new class of nuclear receptor isoforms. Nucleic Acids Res. 29: 49014908.[Abstract/Free Full Text]
- Brocard, J., P. Kastner, and P. Chambon. 1996. Two novel RXR alpha isoforms from mouse testis. Biochem. Biophys. Res. Commun. 229: 211218.[CrossRef][Medline]
- Menuet, A., I. Anglade, G. Flouriot, F. Pakdel, and O. Kah. 2001. Tissue-specific expression of two structurally different estrogen receptor alpha isoforms along the female reproductive axis of an oviparous species, the rainbow trout. Biol. Reprod. 65: 15481557.[Abstract/Free Full Text]
- Encio, I. J., and S. D. Detera-Wadleigh. 1991. The genomic structure of the human glucocorticoid receptor. J. Biol. Chem. 266: 71827188.[Abstract/Free Full Text]
- Bommer, M., A. Benecke, H. Gronemeyer, and C. Rochette-Egly. 2002. TIF2 mediates the synergy between RARalpha 1 activation functions AF-1 and AF-2. J. Biol. Chem. 277: 3796137966.[Abstract/Free Full Text]
- Benecke, A., P. Chambon, and H. Gronemeyer. 2000. Synergy between estrogen receptor alpha activation functions AF1 and AF2 mediated by transcription intermediary factor TIF2. EMBO Rep. 1: 151157.[CrossRef][Medline]
- Kobayashi, Y., T. Kitamoto, Y. Masuhiro, M. Watanabe, T. Kase, D. Metzger, J. Yanagisawa, and S. Kato. 2000. p300 mediates functional synergism between AF-1 and AF-2 of estrogen receptor alpha and beta by interacting directly with the N-terminal A/B domains. J. Biol. Chem. 275: 1564515651.[Abstract/Free Full Text]
- Adam-Stitah, S., L. Penna, P. Chambon, and C. Rochette-Egly. 1999. Hyperphosphorylation of the retinoid X receptor alpha by activated c-Jun NH2-terminal kinases. J. Biol. Chem. 274: 1893218941.[Abstract/Free Full Text]
- Venables, J. P. 2002. Alternative splicing in the testes. Curr. Opin. Genet. Dev. 12: 615619.[CrossRef][Medline]

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. K. Iyer, Y.-H. Zhang, and E. R. B. McCabe
Dosage-Sensitive Sex Reversal Adrenal Hypoplasia Congenita Critical Region on the X Chromosome, Gene 1 (DAX1) (NR0B1) and Small Heterodimer Partner (SHP) (NR0B2) Form Homodimers Individually, as Well as DAX1-SHP Heterodimers
Mol. Endocrinol.,
October 1, 2006;
20(10):
2326 - 2342.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
Advertisement
Advertisement
|