Advertisement
J. Lipid Res.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1194/jlr.D500005-JLR200 on April 1, 2005

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
D500005-JLR200v1
46/6/1339    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sabirsh, A.
Right arrow Articles by Owman, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sabirsh, A.
Right arrow Articles by Owman, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Journal of Lipid Research, Vol. 46, 1339-1346, June 2005
Copyright © 2005 by American Society for Biochemistry and Molecular Biology


Methods

Fluorescent leukotriene B4: potential applications

Alan Sabirsh1,*, Anders Wetterholm*, Jesper Bristulf{dagger}, Hakon Leffler§, Jesper Z. Haeggström* and Christer Owman{dagger}

* Department of Medical Biochemistry and Biophysics, Division of Physiological Chemistry II, Karolinska Institute, Stockholm, Sweden
{dagger} Department of Physiological Sciences, Division of Molecular Neurobiology, Lund University, Lund, Sweden
§ Department of Laboratory Medicine, Division of Microbiology, Immunology, and Glycobiology, Lund University, Lund, Sweden

Published, JLR Papers in Press, April 1, 2005. DOI 10.1194/jlr.D500005-JLR200

1 To whom correspondence should be addressed. e-mail: alan.sabirsh{at}mbb.ki.se


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leukotriene B4 (LTB4) is a potent lipid mediator of inflammation that acts primarily via a seven-transmembrane-spanning, G-protein-coupled receptor denoted BLT1. Here, we describe the synthesis and characterization of fluorescent analogs of LTB4 that are easy to produce, inexpensive, and without the disadvantages of a radioligand. Fluorescent LTB4 is useful for labeling LTB4 receptors for which no antibodies are available and for performing one-step fluorescence polarization assays conducive to high-throughput screening. We found that orange and green fluorescent LTB4 were full agonists that activated the LTB4 receptor BLT1 with EC50 values of 68 and 40 nM, respectively (4.5 nM for unmodified LTB4). Flow cytometric measurements and confocal imaging showed that fluorescent LTB4 colocalized with BLT1. Fluorescence polarization measurements showed that orange fluorescent LTB4 bound to BLT1 with a Kd of 66 nM and that this binding could be displaced by unlabeled LTB4 and other BLT1-specific ligands. Fluorescent LTB4 analogs were also able to displace tritiated LTB4. Orange fluorescent LTB4 binding to enhanced green fluorescent protein-tagged BLT1 could be observed using fluorescence resonance energy transfer.

In addition to being a useful alternative to radiolabeled LTB4, the unique properties of fluorescently labeled LTB4 allow a variety of detection technologies to be used.

Supplementary key words G-protein coupled receptor • pharmacology • method


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leukotriene B4 (LTB4) is a proinflammatory lipid mediator generated from arachidonic acid, stored in phospholipids of the nuclear membrane, by the sequential action of phospholipase A2, 5-lipoxygenase, and LTA4 hydrolase (1). In humans, LTB4 is produced primarily by leukocytes of the myeloid lineage, and as a potent chemoattractant, it is important for directing leukocytes toward infected or inflamed tissues. Knockout experiments, deleting either LTA4 hydrolase (2) or the high-affinity LTB4 receptor BLT1 (3, 4), have shown that in animals unable to produce or respond to LTB4, death occurs after infections that would normally not be fatal and that this correlates with a lack of leukocyte infiltration into infected tissues. These data agree well with a recent report demonstrating that LTB4, administered systemically to healthy volunteers promotes the production of antiviral cytokines (5). It has also been known for many years that LTB4 plays a role in almost every pathophysiological condition involving inflammation, and this list has recently been expanded to include atherosclerosis as well (69). Recently, LTB4 has also been found to modulate the behavior of lymphocytes, providing a link between the activation of the early innate immune system and the long-term adaptive immune responses (10).

The physiology of LTB4 is complex, and this is partly because this mediator binds to several different receptor proteins in addition to BLT1. Another G-protein-coupled receptor, BLT2, also binds LTB4, but with lower affinity (1113). Unlike BLT1, this receptor is expressed in many tissues, but its physiological role remains unclear. LTB4 has also been shown to bind to and activate the vanilloid receptor VR1 (14) and the nuclear peroxisome proliferator-activating receptor {alpha} (15).

Radiolabeled LTB4 is difficult to synthesize and is, at times, commercially unavailable, which is impeding molecular pharmacological studies of LTB4 receptors. Furthermore, commercially available antibodies only recognize the human isoform of the LTB4 receptor BLT1 (16), making it impossible to assess LTB4 receptor expression in other species. The current interest in LTB4 as an immunomodulatory agent has also created a need for a method that would allow LTB4 receptor expression to be easily evaluated in mouse tissues. A fluorescently labeled derivative of LTB4, compatible with a range of fluorescence-based optical techniques, could potentially be useful for this purpose. In addition, a fluorescent ligand would permit real-time measurements to be made at true equilibrium using fluorescence polarization and fluorescence resonance energy transfer (FRET) techniques. These measurements are made in homogenous mixtures requiring no further handling, which is ideal for high-throughput screening. This also facilitates experiments involving soluble LTB4 binding proteins that are not compatible with methodologies that use filtration-based techniques to measure binding. Finally, by carefully choosing the fluorophores used to label LTB4, it is possible to use FRET to evaluate ligand binding to receptors.

Here, we present the synthesis of fluorescent LTB4 molecules. We show that these ligands bind to and activate BLT1 and that they can be used successfully to study BLT1 receptors using a variety of techniques incompatible with radiolabeled LTB4, including flow cytometry, confocal microscopy, fluorescence polarization, and FRET. This will allow LTB4 physiology to be studied at equilibrium, over time, and in tissues or biochemical systems that have previously been inaccessible.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and reagents
All reagents were purchased from Sigma, unless stated otherwise. RP69698 was obtained from Rhône-Poulenc/Aventis (Vitry Sur Seine, Cedex, France). LTB4 antiserum was obtained from Cayman Chemical (Ann Arbor, MI) and Assay Designs (Ann Arbor, MI). Hydroxamate, RB 3040, and Kelatorphan were generous gifts from Prof. B. P. Roques (UFR des Sciences Pharmaceutiques et Biologiques). All leukotrienes were from Biomol (Plymouth Meeting, PA).

Anti-BLT1 receptor antibody 7B1 (16) was obtained from Serotec. The molar antibody concentration was calculated using the molecular weight of the appropriate (mouse) immunoglobulin isotype obtained from the crystal structure (17). The concentration of protein in the antibody solution was determined using a protein assay according to the manufacturer's instructions (BCA Protein AssayTM; Pierce, Rockford, IL). Antibody concentrations should be regarded as approximate because of uncertainties regarding their actual weight and the concentration of active antibody in antibody solutions.

Purified LTA4 hydrolase was produced as described previously (18).

Labeling LTB4 with Alexa FluorTM dyes
Fluorophore-labeled LTB4 was produced using LTB4-aminopropylamide (LTB4-APA; Biomol), and amine reactive succinimidyl esters of Alexa FluorTM dyes (Molecular Probes, Eugene, OR) were dissolved in methanol to a concentration of 1 mM. LTB4-APA was dried in a nitrogen atmosphere and redissolved in methanol to a concentration of 1.28 mM.

LTB4-APA and Alexa FluorTM dye solutions were mixed at a ratio of 1:2 and incubated for 60 min at room temperature with continuous stirring. The LTB4-APA-Alexa FluorTM product was isolated using reverse-phase HPLC with a Nova Pak C18 column (Waters, Milford, MA) and a mobile phase consisting of methanol-water-acetate at a ratio of 60:40:0.08 (pH set to 6.8 using NaOH).

The fractions containing LTB4-APA and fluorescent LTB4 were collected, and the HPLC mobile phase was removed by diluting each sample 1:1 with water and then filtering through Supel CleanTM LC-18 columns (Supelco/Sigma-Aldrich, Bellefonte, PA). Both LTB4-APA and fluorescent LTB4 were retained in the columns and were washed once with water before elution in methanol. The purified substances were dried in a nitrogen atmosphere and redissolved in methanol. Concentrations were determined using adsorbance at 270 nm for LTB4-APA (extinction coefficient = 50,000) and 365 nm (the Alexa FluorTM portion of the molecule absorbs light at 365 nm, whereas the unmodified LTB4-APA does not). Using fluorescence emission, the concentration of fluorescent versions of LTB4 could also be independently verified by comparison with a standard curve prepared using known quantities of each dye.

The various labeled versions of LTB4 are referred to as "fluorescent LTB4" or LTB4-488 (for the green fluorescent LTB4-APA-Alexa Fluor-488TM conjugate) and LTB4-568 (for the orange fluorescent LTB4-APA-Alexa Fluor-568TM conjugate) as necessary.

Cell culture and construction of HF1pBLT1 cell lines
Cultures of HeLa HF1pBLT1 luciferase reporter cells expressing BLT1 or sham-transfected cells (HF1pSham) were established and maintained according to Kotarsky, Owman, and Olde (19). To create BLT1 receptors that were C-terminally tagged with enhanced green fluorescent protein (EGFP), we used the mammalian expression vector pEAK12 (Edge Biosystems). This vector was used to construct the pEAK-HFTE vector containing a (His)10 tag (H), a FLAG tag (F), and the recognition site for the tobacco etch virus (T) protease followed by EGFP (E). The HFTE cassette was assembled using PCR and cloned into pEAK12 between the EcoRI and NotI sites using standard methods. The open reading frame of the human BLT1 receptor was generated using PCR with the following primers: 5 prime, ATATAAGCTTCCACCATGAACACTACATCTTCT (which includes a HindIII site and a Kozak consensus sequence); and 3 prime, CAGTGAATTCCCGTTCAGTTCGTTTAACTTGAGAG (this primer adds an EcoRI site and removes the natural stop codon). BLT1 was then cloned into pEAK-HFTE between HindIII and EcoRI to generate pEAK-BLTR-HFTE, in which the open reading frame of BLT1 was in frame with, and upstream of, the HFTE cassette such that all three tags and the protease site were added to the C-terminal end of the expressed receptor protein. The integrity of the construct was confirmed by sequencing with BigDye (Applied Biosystems). HeLa HF1 cells were stably transfected with pEAK-BLT1-HFTE to produce HF1pBLT1-EGFP cells.

Neutrophils were purified from buffy coats using density gradient centrifugation (Lymphoprep; Axis-Shield, Oslo, Norway) after dextran sedimentation of erythrocytes. Purity and viability were determined using May-Grunwald-Giemsa staining and trypan blue exclusion, respectively. The resulting cell cultures contained at least 95% neutrophils, and the cells were at least 99% viable.

Membrane preparation
Cell cultures were grown on tissue culture plates until confluent and then chilled to 4°C. The cell growth medium was removed and the cells were rinsed once with ice-cold PBS, before ice-cold Tris-HCl buffer (50 mM Tris base, 5 mM MgCl2, and 1 mM EGTA, pH 7.5) was added to each plate. The cells were then scraped off and homogenized using a motorized Teflon pestle.

The cell homogenates were centrifuged at 1,000 g for 10 min at 4°C. The pellet was discarded, additional buffer was added, and the supernatant was rehomogenized. The resulting homogenate was centrifuged at 100,000 g for 60 min at 4°C, and the supernatant was discarded, additional buffer was added, and the pellet was rehomogenized. The membrane protein concentration was determined (BCA protein assayTM), and the membrane isolates were portioned into aliquots before they were frozen at –80°C until use.

Confocal microscopy
For confocal microscopic studies, HF1pBLT1-EGFP and HF1pSham cells were seeded onto poly-D-lysine-coated cover slips at least 24 h before use. Just before staining, the cells were chilled to 4°C and rinsed with PBS. After addition of 100 nM LTB4-568, the cells were incubated for 60 min at 4°C. The cells were then washed four times and fixed with 4% (w/v) paraformaldehyde for 5 min at room temperature. The expression of BLT1-EGFP and LTB4-568 binding were then examined using a TCS SP2 confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany) equipped with an argon laser (488 nm emission line) and a green He/Ne laser (543 nm emission line), respectively.

Flow cytometry
Flow cytometric analysis of HF1pBLT1 and HF1pSham cells was performed using a FACSVantageTM (Becton Dickinson, Franklin Lakes, NJ). After staining with 100 nM LTB4-568, fluorescence was analyzed using a FACSArray bioanalyzer (Becton Dickinson) equipped with a green diode laser emitting 532 nm light.

Radioligand binding assays
Radioligand binding assays were performed using opaque white 96-well filter plates with FC glass fiber filters (model MAFC-NOB, Multiscreen Assay System; Millipore, Bedford, MA). The plates were presoaked with binding buffer (0.02 M HEPES, 10 mM CaCl2, and 10 mM MgCl2·6H2O, pH 7.5), which was then exchanged for 75 µl of binding buffer containing 1.0 nM [3H]LTB4 and, if necessary, 2.0 µM unlabeled LTB4 to determine nonspecific binding. The binding reaction was started by adding another 75 µl of binding buffer containing 1.0 µg of rehomogenized cell membrane and the appropriate concentration of any test substance. The membrane-ligand solution was incubated for 1 h at room temperature. The reaction was terminated by rapid filtration, and the filters were then washed three times with 200 µl volumes of ice-cold washing buffer (20 mM Tris-base and 0.5 g/l BSA). Excess washing buffer was removed by blotting, and the plates were dried at 40°C for 30 min. Twenty-five microliters of Microscint-O (Perkin-Elmer, Boston, MA) was then added to each well, and [3H]LTB4 binding was evaluated using a MicroBeta scintillation counter (Perkin-Elmer).

FRET analysis of fluorescent LTB4 binding to BLT1
HF1pSham, HF1pBLT1, and/or HF1pBLT1-EGFP cells were seeded onto black, clear-bottomed 96-well plates at least 48 h before use. Just before use, the cells were chilled to 4°C and gently washed three times in an ice-cold buffer solution (135 mM NaCl, 4.6 mM KCl, 1.2 mM MgCl2, 1.5 mM CaCl2, 11 mM glucose, and 10 mM HEPES, pH 6.0, 7.5, or 9.0). Fifty microliters of cold buffer containing LTB4-488 or LTB4-568, or both, was added to appropriate wells, with or without excess unlabeled LTB4. The cells were then incubated for 30 min at 4°C before they were washed three times with chilled buffer. Fluorescence and FRET were measured using a fluorometer (PolarStarTM; BMG Labtech, Offenburg, Germany) chilled to <16°C. After fluorescence analysis, cell morphology was checked microscopically, the cells were counted, and the results were corrected for cell density. Cells on the same plate were also challenged with 100 nM LTB4 to ensure that functional BLT1 receptors were expressed. The resulting calcium release was visualized using FURA2-AM according to previously reported methods (20).

Fluorescence polarization assays of fluorescent LTB4 binding
Fluorescence polarization assays of fluorescent LTB4 binding to membrane preparations were performed in a total volume of 50 µl of binding buffer (0.02 M HEPES, 10 mM CaCl2, and 10 mM MgCl2·6H2O, pH 7.5) on black, 96-well, low-volume (50 µl/well) plates from Molecular Devices. For competition experiments, membrane preparations were added to each well (at a concentration of 10 µg protein/well) together with the appropriate competitor or 1 µM LTB4 and 10 nM fluorescent LTB4. The membranes were incubated at room temperature for 1 h before fluorescent ligand binding was analyzed using a fluorometer (PolarStarTM) equipped to measure fluorescence polarization. For each competitor or LTB4, the concentration that inhibited half of the specific binding (IC50) of fluorescent LTB4 was determined when possible from competitive binding curves using nonlinear regression (Prism; GraphPad Software, San Diego, CA). For measurements of ligand binding to purified soluble proteins, the procedure was essentially the same as described above, and molar concentrations were calculated, after protein determination, using molar weights obtained from crystallographic structures.

For measurements of fluorescent LTB4 association and dissociation, a final concentration of 10 nM fluorescent LTB4 was added to membrane preparations as described above, and repeated polarization measurements were made over 30 min before adding a final concentration of 1 µM LTB4 and measuring polarization for a further 30 min. Saturation experiments were performed using up to 100 nM fluorescent LTB4 with or without 10 µM LTB4. Results are presented in millipolars calculated as (|| – {perp})/(|| + {perp}) x 1,000, where || is fluorescence emission polarized in parallel to the excitation source and {perp} is perpendicularly polarized fluorescence emission.

Fluorescence assays of fluorescent LTB4 binding
Fluorescent LTB4 binding to whole cells was examined using cells growing on black, clear-bottomed, 96-well plates. The protocol was similar to that used for fluorescence polarization, except that the final incubation volume was 100 µl and the entire procedure was performed at 4°C with an incubation time of 30 min. After the incubation, the cells were washed four times with PBS Dulbecco's, and then all fluid was removed from the wells. Fluorescence was measured using a fluorometer (FluostarTM; BMG).

Luciferase assay of BLT1 activity
The assay for agonist-induced luciferase production was performed according to Kotarsky, Owman, and Olde (19). This assay is used here to measure the relative potencies and efficacies of LTB4 and its fluorescent counterparts. Briefly, HF1pBLTR1 cells were seeded as described above onto white, clear-bottomed, 96-well plates (Corning Costar, Corning, NY) and grown until they were 80–90% confluent. PBS solutions containing ligands were then added (in a volume not exceeding 10 µl) to the wells (results are reported as final ligand concentrations). After a further 16 h of incubation, the cells were washed once with PBS and lysed. Luciferase activity was measured using a 96-well luminometer (LumistarTM; BMG). The half-maximum effective ligand concentrations (EC50) were determined from the luciferase assay concentration response curves using nonlinear regression (Prism), and results are presented as mean EC50 values with 95% confidence intervals.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Synthesis of fluorescent LTB4
The reaction between LTB4-APA and the succinimidyl ester of the Alexa FluorTM dye is simple (Fig. 1) and proceeds at room temperature, resulting in ~30% labeled LTB4-APA after 1 h. The reaction mixture is slightly acidic (pH 6.0) and the yield was found to decrease significantly if the pH was increased using sodium hydroxide. The unreacted Alexa FluorTM dye passed through the column immediately followed by fluorescent LTB4 and unreacted LTB4-APA. The two reaction components and the product could be detected using 270 nm absorption. Some additional reaction products were also detected, particularly after the Alexa FluorTM dye was stored (after solvation) for more than 5 months at –80°C, but these contaminants were easily distinguished from fluorescent LTB4.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. The synthesis of fluorescent leukotriene B4 (LTB4-FL) from LTB4-aminopropylamide (LTB4-APA) and Alexa FluorTM fluorophores. The free amino group of LTB4-APA hydrolyzes the succinimidyl ester to form mixed isomers of LTB4 Alexa FluorTM 568 or 488 (fluorescent LTB4).

 
Fluorescence polarization measurements
We used a PolarStarTM (BMG) to measure the fluorescent anisotropy (polarization) of labeled LTB4, and this machine was found, under our experimental conditions, to be sensitive in a linear manner over concentrations ranging from >100 nM to 1 nM. Although the concentration of fluorescent LTB4 did not affect the average fluorescence polarization over this range, concentrations less than 5 nM approached the noise floor of the assay and tended to produce erratic polarization values. Solutions with increasing concentrations of glycerol were also used to evaluate the dynamic range of fluorescence polarization values that could be obtained using fluorescent LTB4. Fluorescent LTB4 was found to be sensitive to increasing glycerol concentrations, although not as sensitive as the free Alexa FluorTM fluorophores, which had a larger dynamic range. The polarity shift of fluorescent LTB4 was not sensitive to the addition of unlabeled LTB4.

Fluorescent LTB4 as a BLT1 agonist
The ability of fluorescent LTB4 to activate HF1pBLT1 luciferase reporter cells was studied by comparing unmodified LTB4 with labeled LTB4. The EC50 for LTB4 was 4.5 nM (1.7–12) (means and 95% confidence intervals), whereas the EC50 for LTB4-568 was found to be ~15 times higher at 68 nM (31–150), and the EC50 for LTB4-488 was found to be ~10 times higher at 40 nM (25–78). Both ligands were full agonists. The EC50 for LTB4 was not affected by the addition of free Alexa FluorTM dye, even at concentrations as high as 10 µM.

Fluorescent LTB4 and BLT1 binding experiments
The binding of labeled LTB4 to BLT1 was examined using membranes prepared from HF1pBLT1 cells and measurements of fluorescence polarization. LTB4-568 affinity for BLT1 was calculated to be Kd = 66 nM (43–76) with a receptor concentration (Bmax) of 60 nM (31–101) according to the method of Prystay, Gosselin, and Banks (21). Accordingly, the association rate for LTB4-568 was found to have an observed rate constant of 0.35 min–1 (0.33–0.37), so that specific binding of LTB4-568 by BLT1 was essentially complete after 20 min. LTB4-568 is displaced quickly by unlabeled LTB4, and it was impossible, for technical reasons, to make the first polarization measurement before a significant portion of the bound LTB4-568 had been displaced. The specific LTB4-568 binding could be displaced using unlabeled LTB4, with an IC50 of 110 nM (78–160), and also by the LTB4 antagonist RP69698 [IC50 = 1.60 µM (0.94–2.70)], the BLT1-specific partial agonist U75302 [IC50 = 2.10 µM (0.14–3.0)], and a BLT1 antibody [IC50 = 1.9 µM (0.1–3.6) approximate concentration; see Materials and Methods], but not by the chemically related LTC4 or an isotype control antibody (Fig. 2). In competition experiments, there was no difference in the ability of unlabeled LTB4 to displace labeled LTB4, regardless of when the unlabeled ligand was added. No specific binding of fluorescent LTB4 was observed when using sham-transfected HF1 cells or their membranes.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Competition between LTB4-568 and various ligands for BLT1 binding. Displacement of LTB4-568 (10 nM) binding to HF1pBLT1 cell membranes (10 µg/well) by unlabeled LTB4, the LTB4 antagonist RP69698, the BLT1-specific partial agonist U75302, and the BLT1 receptor antibody 7B1. Isotype control antibodies (Iso) and LTC4 (which is not a ligand for BLT1) did not displace LTB4-568 binding. Data are presented as means ± SEM from triplicate wells in two separate experiments performed at 24°C.

 
The interaction between fluorescent LTB4 and BLT1 was also examined using conventional nonequilibrium binding experiments. Measuring fluorescence bound to whole cells expressing BLT1, similar binding constants were obtained for LTB4-568 affinity [Kd = 64 nM (27–102)] and LTB4-568 displacement by LTB4 [IC50 = 75 nM (36–156)]. The ability of fluorescently labeled LTB4 to displace tritiated LTB4 was also evaluated using membranes prepared from HF1pBLT1 cells. Tritiated LTB4 could be displaced using unlabeled LTB4 with a calculated IC50 of 3 nM (2.1–4.6), by LTB4-488 [IC50 = 11 nM (5–26)], LTB4-568 [IC50 = 22 nM (12–38)], and LTB4-APA [IC50 = 180 nM (91–360)].

Colocalization of fluorescent LTB4 and EGFP-tagged BLT1
Confocal microscopy of HF1pBLT1 cells revealed that the cell surface expression of EGFP-tagged receptors and LTB4-568 fluorescence overlapped (Fig. 3C). Flow cytometric analysis of cells expressing a C-terminal EGFP-tagged BLT1 receptor and surface labeled with BLT1 antibodies indicated that more than 90% of the expressed receptors could be found on the cell surface (Fig. 3A). This same population of cells bound LTB4-568 specifically, and this binding could be displaced using unlabeled LTB4 (Fig. 3B). Sham-transfected cells did not specifically bind LTB4-568, and cells exposed to only Alexa Fluor 568TM could not be differentiated from unlabeled cells (Fig. 3B). To demonstrate that fluorescent LTB4 could also label immunologically relevant cells, we also labeled neutrophils with LTB4-568 or with LTB4-568 and excess unlabeled LTB4 to measure nonspecific binding. Nonspecific binding represented only ~15% of the total binding under these conditions. In other words, LTB4-568 labeling made the neutrophils approximately six times brighter than background, demonstrating that fluorescent LTB4 can be used to detect LTB4 receptors even in cell populations that are not overexpressing the receptors.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3. Colocalization of LTB4-568 and enhanced green fluorescent protein (EGFP)-tagged BLT1. A: Flow cytometric analysis of HF1 cells expressing BLT1 receptors that were C-terminally tagged with EGFP. The green fluorescence of the EGFP tag was used to measure the total number of receptors in each cell, and the red fluorescence of a BLT1 antibody was used to measure surface expression. In combination, these measurements reveal that more than 90% of the receptor is on the cell surface (the percentage of double positive cells is given in the upper right quadrant of each scattergram). B: Representative curves showing that HF1pBLT1-EGFP cells bind 100 nM LTB4-568 (grey shading) specifically. Also shown are curves depicting LTB4-568 nonspecific binding (100 nM LTB4-568 displaced using 10 µM LTB4) and HF1pSham cells, which exhibited the same level of nonspecific binding and a lack of specific binding. C: LTB4-568 staining of HF1pBLT1-EGFP cells and HF1pSham cells observed using confocal microscopy. Green EGFP fluorescence from tagged receptors in the cell membranes colocalized with the orange fluorescence from LTB4-568. D: Neutrophils isolated from buffy coats were stained with either 10 nM LTB4-568 (to determine total binding) or LTB4-568 together with 1µM LTB4 (to determine nonspecific binding) before LTB4-568 fluorescence was quantified using a plate fluorometer. The addition of unlabeled LTB4 could displace almost 85% of the LTB4-568 fluorescence. Data shown are means ± SEM from quadruplicate wells and two separate donors.

 
We also performed a FRET analysis of LTB4-568 binding to EGFP-tagged BLT1 receptors. In contrast to EGFP, LTB4-568 is poorly excited by blue light (485 nm). When LTB4-568 was added to membrane preparations from cells expressing EGFP-tagged BLT1, the yellow-green EGFP fluorescence emission was able to stimulate LTB4-568 molecules in close proximity, which reemitted this light as red-orange (610 nm) fluorescence (Fig. 4). LTB4-568 does emit some fluorescence at 610 nm even when stimulated with 485 nm light, but the effect is much larger in the presence of BLT1-EGFP, indicating that the ligand and the receptor are in close proximity. Membranes from HF1pSham cells did not exhibit this effect. The observed energy transfer could also be disrupted by adding excess unlabeled LTB4.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. Fluorescence resonance energy transfer (FRET) from EGFP-tagged BLT1 to LTB4-568. Membranes prepared from cells expressing EGFP-tagged BLT1 were illuminated with 485 nm light, and fluorescence emission at 520 or 610 nm was recorded. FRET between BLT1-EGFP and LTB4-568 is revealed as a shift from 520 nm fluorescence emission to 610 nm emission. LTB4-568 was added to wells containing membranes (white bars), membranes plus an excess of unlabeled LTB4 (light gray bars), no membranes (dark gray bars), or a buffer control (no fluorophores; black bars). After the addition of LTB4-568, much more orange-red (610 nm) fluorescence was produced by membranes containing EGFP that were stimulated with 485 nm (blue) light. Data have been normalized to the green fluorescence of EGFP and are shown as means ± SEM from quadruplicate wells in two separate experiments. The x axis shows excitation/emission wavelengths in nanometers.

 
Fluorescent LTB4 binding to enzymes and carrier proteins
LTB4-568 binding to putative carrier proteins was also examined, and it was found that LTB4-568 could bind to albumin. This binding was unique to albumin, but it could not be reversed by adding excess quantities of unlabeled LTB4 (Fig. 5).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. LTB4-568 binding to serum albumin. A: LTB4-568 was added to solutions each containing one of three different polypeptides or the free amino acid glycine. Over a wide range of concentrations, only human serum albumin (HSA) bound LTB4-568. B: LTB4-568 (closed diamonds) was added to albumin solution with concentrations ranging from 1 µg/ml to 1 mg/ml, and binding was observed to increase in proportion to the albumin concentration. This binding, however, was not restricted to a site specific for the leukotriene moiety of LTB4-568, because the addition of excess unlabeled LTB4 (1 µM) displaced LTB4-568 only slightly (closed squares). Data are presented as means ± SEM from quadruplicate wells in two separate experiments performed at 24°C. mP, millipolars.

 
Similarly, we found that both LTB4-488 and LTB4-568 could bind to LTA4 hydrolase, the enzyme responsible for LTB4 production in tissues (data not shown). Over a range of concentrations (1–100 nM), fluorescent LTB4 bound to LTA4 hydrolase but could not be displaced by excess unlabeled LTB4 or various inhibitors (RB 3040, Kelatorphan, or the substrate mimic hydroxamate), indicating that the observed binding was probably nonspecific.

LTB4 and a fluorescence polarization immunoassay
We attempted to measure the concentration of free unlabeled LTB4 by allowing it to compete with labeled LTB4 for binding to a polyclonal rabbit anti-LTB4 peroxidase antibody (Cayman Chemical) and a polyclonal rabbit anti-LTB4 antibody (Assay Designs). Fluorescent LTB4 was not recognized by either antibody solution, even at antibody concentrations 100 times those recommended by the manufacturer. Therefore, it will be necessary to produce antibodies specific for fluorescent LTB4 before a one-step fluorescence polarization immunoassay can be produced.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Synthesis and activity of fluorescent LTB4
Our fluorescent LTB4 analogs can reversibly bind to the LTB4 receptor BLT1 and function as full agonists. Fluorescent LTB4 bound specifically to BLT1 because this binding could be displaced, not only by unlabeled LTB4 but also by the BLT1-specific partial agonist U75302, the LTB4 antagonist RP69698, and a BLT1 antibody that has been shown to interfere with LTB4 binding (22). LTB4-568, however, does not bind very tightly to BLT1, and there is a discrepancy between the values obtained using polarization measurements, made in homogenous solutions, and radioligand binding experiments. Polarization measurements, however, are made at true equilibrium and are dependent on a significant amount of ligand depletion, which makes the results difficult to compare directly with those of traditional nonequilibrium competition experiments. In spite of this apparent low affinity, LTB4-568 was surprisingly difficult to displace. Ligands that typically displace tritiated LTB4 at concentrations in the nanomolar range (such as LTB4 itself) required higher concentrations to displace fluorescent LTB4. This may be because the fluorophore portion of fluorescent LTB4 participates in the ligand-receptor interaction. Excess free fluorophore, however, did not affect the binding or function of fluorescent LTB4, so the mechanism appears to be more complex and may depend on interaction between epitopes from both the leukotriene and the fluorophore. This is supported by the observation that fluorescent LTB4 binds more strongly to BLT1 than LTB4-APA. Baneres and Parello (23) have shown that LTB4 binding induces the dimerization of purified BLT1 receptors, which in turn increases BLT1 affinity for LTB4. However, preincubating the receptors with either fluorescent LTB4 or LTB4 before adding LTB4 or fluorescent LTB4, respectively, did not affect the results. Nor are the apparently low ligand affinities dependent on active receptor conformations (and presumably G-protein coupling), as even antagonists (both small molecules and antibody peptides) bound more weakly than expected and were insensitive to the order in which they were added.

Fluorescent versions of LTB4 bind to and activate BLT1 specifically, but they are somewhat less potent agonists compared with unmodified LTB4. They are not partial agonists, however, because the addition of labeled LTB4 to LTB4 solutions did not affect receptor activation by LTB4. Exposure to labeled LTB4 could also provoke equally large responses, provided the concentrations used were high enough.

LTB4, modified such that the hydroxyl portion of the carboxyl group is exchanged for aminopropylamide, has previously been used to chemically label receptors for LTB4 (24), and this ligand retains agonistic activity. It also reacts readily with a variety of fluorophores that have been designed to include succinimidyl esters to facilitate labeling of the free amino groups found in proteins. Although we have focused on Alexa FluorTM 488 and 568, any fluorophore coupled to a succinimidyl ester will react with similar chemistry, allowing the production of labeled LTB4 molecules with emission maxima across the visible spectrum and into infrared.

The location of the fluorophore (Fig. 1) is fortuitous because in this position it allows the LTB4 moiety to bind to and interact with BLT1. Receptor modeling, ligand docking experiments, and point mutation of the receptor protein (our unpublished data) also support this idea.

Using the unique optical properties of fluorescent LTB4
Using the optical properties of fluorescent LTB4, we could locate LTB4 molecules and LTB4 receptors in living cells using a variety of techniques incompatible with radiolabeled LTB4, including flow cytometry, fluorescence histochemistry, and the aforementioned fluorescence polarization.

We also used fluorescently labeled LTB4 to label membranes from cells expressing BLT1 receptors that were tagged at the C-terminal end with EGFP and observed both physical overlap between the two fluorophores and resonance energy transfer between the fluorescent ligand and the tagged receptor. The red shift in EGFP fluorescence after LTB4-568 binding could also be reversed by the addition of unlabeled LTB4, implying that this is not attributable to random interactions between EGFP and LTB4-568 molecules in close proximity. Although we did observe binding to purified samples of the cytosolic LTA4 hydrolase (see below), no cytosolic staining was observed in preparations of intact cells. This may be because, unlike leukocytes, parenchymal cells do not express LTA4 hydrolase protein, or because fluorescent LTB4 does not cross intact cell membranes.

Fluorescent LTB4 binding to water-soluble proteins
One advantage of using fluorescent polarization is that there is no need to separate unbound ligand from bound ligand before measuring ligand binding. This in turn means that measuring fluorescent LTB4 binding to soluble proteins is, a least theoretically, relatively straightforward. Molecules that bind fluorescent LTB4 are interesting because many represent possible drug targets and could be used as platforms for high-throughput screening. If the displacement of fluorescent LTB4 from LTA4 hydrolase by specific enzymatic inhibitors could be measured using fluorescence polarization, this would create a one-step homogenous assay for screening enzymatic inhibitors. The binding of labeled LTB4 to serum albumin showed that fluorescent LTB4 can bind to this important serum protein. Unlike fluorescent LTB4 binding to BLT1, however, binding to serum albumin could not be displaced by unlabeled LTB4, indicating that there are not specific binding epitopes for the LTB4 moiety. Free Alexa FluorTM 568 dye was also unable to displace serum albumin-bound LTB4-568, suggesting that it was not binding of the fluorophore alone that was responsible for LTB4-568 binding. Similar results were obtained using LTA4 hydrolase, the enzyme responsible for the enzymatic production of LTB4 and polyclonal antibodies specific for LTB4. Although we did observe binding to LTA4 hydrolase, this binding was not specific and could not be displaced by unlabeled LTB4 or various LTA4 hydrolase inhibitors. The two different antibodies we examined, which were designed for use in immunoassays, did not recognize (bind to) our fluorescent LTB4 analogs.

Conclusions
Fluorescent LTB4 has several advantages over native LTB4 and tritiated LTB4. Fluorescent LTB4 is not radioactive and thus is safer to handle. Fluorescently labeled LTB4 is also significantly cheaper than tritiated LTB4, assuming that tritiated LTB4 can be purchased at all. Fluorescent LTB4 can also be used to label receptors for LTB4 in tissues that are incompatible with currently available antibodies (at present, only antibodies against the human BLT1 receptor are commercially available). The fact that fluorescent labels can be easily detected optically makes these LTB4 analogs compatible with a range of techniques, including flow cytometry, microscopy, polarization, and resonance energy transfer. This in turn makes it possible to study LTB4 binding proteins in new ways, in new tissues with fewer steps, at higher throughput, even in homogenous solutions.


    ACKNOWLEDGMENTS
 
This study was financially supported by the AFA Health Foundation, the Swedish Research Council (03X-10350), Konung Gustav V:s 80 årsfond, and European Commision FP6 funding (LSHM-CT-2004-005033). This publication reflects only the authors' views. The European Commission is not liable for any use that may be made of information herein.

Submitted on February 15, 2005
Revised on March 17, 2005


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
  1. Funk, C. D. 2001. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science. 294: 1871–1875.[Abstract/Free Full Text]

  2. Byrum, R. S., J. L. Goulet, J. N. Snouwaert, R. J. Griffiths, and B. H. Koller. 1999. Determination of the contribution of cysteinyl leukotrienes and leukotriene B4 in acute inflammatory responses using 5-lipoxygenase- and leukotriene A4 hydrolase-deficient mice. J. Immunol. 163: 6810–6819.[Abstract/Free Full Text]

  3. Haribabu, B., M. W. Verghese, D. A. Steeber, D. D. Sellars, C. B. Bock, and R. Snyderman. 2000. Targeted disruption of the leukotriene B(4) receptor in mice reveals its role in inflammation and platelet-activating factor-induced anaphylaxis. J. Exp. Med. 192: 433–438.[Abstract/Free Full Text]

  4. Tager, A. M., J. H. Dufour, K. Goodarzi, S. D. Bercury, U. H. von Andrian, and A. D. Luster. 2000. BLTR mediates leukotriene B(4)-induced chemotaxis and adhesion and plays a dominant role in eosinophil accumulation in a murine model of peritonitis. J. Exp. Med. 192: 439–446.[Abstract/Free Full Text]

  5. Flamand, L., P. Borgeat, R. Lalonde, and J. Gosselin. 2004. Release of anti-HIV mediators after administration of leukotriene B4 to humans. J. Infect. Dis. 189: 2001–2009.[CrossRef][Medline]

  6. Aiello, R. J., P. A. Bourassa, S. Lindsey, W. Weng, A. Freeman, and H. J. Showell. 2002. Leukotriene B4 receptor antagonism reduces monocytic foam cells in mice. Arterioscler. Thromb. Vasc. Biol. 22: 443–449.[Abstract/Free Full Text]

  7. Subbarao, K., V. R. Jala, S. Mathis, J. Suttles, W. Zacharias, J. Ahamed, H. Ali, M. T. Tseng, and B. Haribabu. 2003. Role of leukotriene B4 receptors in the development of atherosclerosis: potential mechanisms. Arterioscler. Thromb. Vasc. Biol. 24: 369–375.

  8. Dwyer, J. H., H. Allayee, K. M. Dwyer, J. Fan, H. Wu, R. Mar, A. J. Lusis, and M. Mehrabian. 2004. Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N. Engl. J. Med. 350: 29–37.[Abstract/Free Full Text]

  9. Helgadottir, A., A. Manolescu, G. Thorleifsson, S. Gretarsdottir, H. Jonsdottir, U. Thorsteinsdottir, N. J. Samani, G. Gudmundsson, S. F. Grant, G. Thorgeirsson, et al. 2004. The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat. Genet. 36: 233–239.[CrossRef][Medline]

  10. Tager, A. M., S. K. Bromley, B. D. Medoff, S. A. Islam, S. D. Bercury, E. B. Friedrich, A. D. Carafone, R. E. Gerszten, and A. D. Luster. 2003. Leukotriene B4 receptor BLT1 mediates early effector T cell recruitment. Nat. Immunol. 4: 982–990.[CrossRef][Medline]

  11. Kamohara, M., J. Takasaki, M. Matsumoto, T. Saito, T. Ohishi, H. Ishii, and K. Furuichi. 2000. Molecular cloning and characterization of another leukotriene B4 receptor. J. Biol. Chem. 275: 27000–27004.[Abstract/Free Full Text]

  12. Tryselius, Y., N. E. Nilsson, K. Kotarsky, B. Olde, and C. Owman. 2000. Cloning and characterization of cDNA encoding a novel human leukotriene B(4) receptor. Biochem. Biophys. Res. Commun. 274: 377–382.[CrossRef][Medline]

  13. Wang, S., E. Gustafson, L. Pang, X. Qiao, J. Behan, M. Maguire, M. Bayne, and T. Laz. 2000. A novel hepatointestinal leukotriene B4 receptor. Cloning and functional characterization. J. Biol. Chem. 275: 40686–40694.[Abstract/Free Full Text]

  14. Hwang, S. W., H. Cho, J. Kwak, S. Y. Lee, C. J. Kang, J. Jung, S. Cho, K. H. Min, Y. G. Suh, D. Kim, and U. Oh. 2000. Direct activation of capsaicin receptors by products of lipoxygenases: endogenous capsaicin-like substances. Proc. Natl. Acad. Sci. USA. 97: 6155–6160.[Abstract/Free Full Text]

  15. Devchand, P. R., H. Keller, J. M. Peters, M. Vazquez, F. J. Gonzalez, and W. Wahli. 1996. The PPARalpha-leukotriene B4 pathway to inflammation control. Nature. 384: 39–43.[CrossRef][Medline]

  16. Pettersson, A., A. Boketoft, A. Sabirsh, N. E. Nilsson, K. Kotarsky, B. Olde, and C. Owman. 2000. First-generation monoclonal antibodies identifying the human leukotriene B(4) receptor-1. Biochem. Biophys. Res. Commun. 279: 520–525.[CrossRef][Medline]

  17. Harris, L. J., E. Skaletsky, and A. McPherson. 1998. Crystallographic structure of an intact IgG1 monoclonal antibody. J. Mol. Biol. 275: 861–872.[CrossRef][Medline]

  18. Rudberg, P. C., F. Tholander, M. Andberg, M. M. Thunnissen, and J. Z. Haeggstrom. 2004. Leukotriene A4 hydrolase: identification of a common carboxylate recognition site for the epoxide hydrolase and aminopeptidase substrates. J. Biol. Chem. 279: 27376–27382.[Abstract/Free Full Text]

  19. Kotarsky, K., C. Owman, and B. Olde. 2001. A chimeric reporter gene allowing for clone selection and high-throughput screening of reporter cell lines expressing G-protein-coupled receptors. Anal. Biochem. 288: 209–215.[CrossRef][Medline]

  20. Sabirsh, A., J. Bristulf, and C. Owman. 2004. Exploring the pharmacology of the leukotriene B4 receptor BLT1, without the confounding effects of BLT2. Eur. J. Pharmacol. 499: 53–65.[CrossRef][Medline]

  21. Prystay, L., M. Gosselin, and P. Banks. 2001. Determination of equilibrium dissociation constants in fluorescence polarization. J. Biomol. Screen. 6: 141–150.[Abstract/Free Full Text]

  22. Sabirsh, A., A. Pettersson, Å. Boketoft, K. Kotarsky, and C. Owman. 2003. Differential inhibition of receptor activation by two mouse monoclonal antibodies specific for the human leukotriene B4 receptor, BLT1. Int. Immunopharmacol. 3: 1829–1839.[CrossRef][Medline]

  23. Baneres, J. L., and J. Parello. 2003. Structure-based analysis of GPCR function: evidence for a novel pentameric assembly between the dimeric leukotriene B4 receptor BLT1 and the G-protein. J. Mol. Biol. 329: 815–829.[CrossRef][Medline]

  24. Goldman, D. W., L. A. Gifford, R. N. Young, T. Marotti, M. K. Cheung, and E. J. Goetzl. 1991. Affinity labeling of the membrane protein-binding component of human polymorphonuclear leukocyte receptors for leukotriene B4. J. Immunol. 146: 2671–2677.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Arcemisbehere, T. Sen, L. Boudier, M.-N. Balestre, G. Gaibelet, E. Detouillon, H. Orcel, C. Mendre, R. Rahmeh, S. Granier, et al.
Leukotriene BLT2 Receptor Monomers Activate the Gi2 GTP-binding Protein More Efficiently than Dimers
J. Biol. Chem., February 26, 2010; 285(9): 6337 - 6347.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
D500005-JLR200v1
46/6/1339    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sabirsh, A.
Right arrow Articles by Owman, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sabirsh, A.
Right arrow Articles by Owman, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Molecular and Cellular Proteomics   ASBMB Today 
Advertisement
spacer
Advertisement
Advertisement