|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Papers In Press, published online ahead of print September 1, 2005 J. Lipid Res., doi:10.1194/jlr.M500081-JLR200
Journal of Lipid Research, Vol. 46, 1860-1867, September 2005
Human hormone-sensitive lipase (HSL): expression in white fat corrects the white adipose phenotype of HSL-deficient mice
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
Therefore, 1) WAT expression of normal human HSL markedly improves HSL/ WAT biochemically, physiologically, and morphologically; 2) similar levels of S554A HSL have a low physiological effect despite being active in vitro; and 3) diacylglycerol accumulation is not essential for the development of the characteristic WAT pathology of HSL/ mice.
Abbreviations: aP2, adipocyte fatty acid binding protein; DG, diglyceride; HSL, hormone-sensitive lipase; HSL/, hormone-sensitive lipase-deficient; TG, triglyceride; WAT, white adipose tissue
Supplementary key words hormone-sensitive lipase adipocyte mouse mutation fat metabolism
| INTRODUCTION |
|---|
|
|
|---|
HSL is regulated by phosphorylation on several serine residues. ß-Adrenergic agonists activate HSL by protein kinase A-mediated serine phosphorylation at positions 552, 649, and 650 in human HSL (10, 11). Other kinases can also phosphorylate serine 554 (S554) in vitro, including glycogen synthase kinase-4 and protein kinase II Ca2+/calmodulin-dependent and AMP-activated protein kinase (1214). Phosphorylation at S600 can be mediated by extracellular signal-regulated kinase (15). In addition to phosphorylation, WAT HSL activity is also enhanced by translocation of HSL from the cytoplasm to the lipid droplet surface (16), by dimerization (17), and by interaction with adipocyte fatty acid binding protein (aP2) (18). HSL also reportedly docks with lipotransin (19).
Several groups have studied S554 and orthologous residues in mammalian HSLs (11, 14, 20, 21). In rat HSL, phosphorylation of S565, which corresponds to S554 in human HSL, was associated with lipolytic inactivity and was reportedly incompatible with phosphorylation at S552 (14). Phosphorylation of S563, orthologous to human S552, correlated with active HSL (14). We hypothesized that replacement of S554 with an alanine in human HSL (S554A) might produce a stable peptide, favor S552 phosphorylation, and constitutively activate HSL in vivo. Two in vitro studies of the corresponding rat HSL mutant, S565A, showed it to possess catalytic activity, although one reported low DG hydrolase activity in CHO cells (65% of normal) (20) and the other reported increased activity in COS cells (135%) (11).
To directly study the physiological effect of normal and mutant S554A human HSL, we created transgenic mice that express HSL primarily in WAT from the aP2 promoter (22) and studied their WAT phenotypes on a HSL/ background.
| RESEARCH DESIGN AND METHODS |
|---|
|
|
|---|
Nomenclature of HSL serine residues
Human, rat, and mouse HSLs differ by in-frame deletions/insertions (23). We designate residues by their positions in human HSL unless stated otherwise.
Transgenic mice
HSL vectors (Fig. 1) were constructed. hHSL(1.3)/blue (a generous gift of C. Holm), containing a 1.3 kb human HSL cDNA 3' fragment, was subcloned into pBluescript (SK). Two synonymous mutations were introduced by PCR mutagenesis, A1250C and C1253A, creating a Nde I site at nucleotide 1,250. Then, a fragment spanning nucleotides 18 to 1,260 of human HSL and flanked by the introduced Nde I site and a 5' cloning SalI site was amplified by RT-PCR from human adipocyte RNA and inserted in the Nde I and Sal I sites of hHSL(1.3)/pBluescript (SK), giving a full-length human HSL cDNA. One vector contained the normal HSL sequence. In the other, a T
G transversion at nucleotide 1,662 was introduced by PCR mutagenesis, producing the S554A mutation. The SV40 polyadenylation sequence was cloned after amplification from the SVCMVexPA vector (a generous gift from E. Cohen) (24), and cloned into the EcoRI site, permitting cloning in the EcoRI site immediately 3' to the end of the HSL coding sequence. The introduced sequences were verified by sequencing of both strands. The normal and mutant HSL cDNAs were cloned downstream of the 5.4 kb aP2 promoter in pBluescript (SK) vector (22). For microinjection, the Hind III-Sac II fragment was purified (Qiaquick gel extraction kit; Qiagen, Mississauga, Ontario, Canada) and introduced to the pronuclei of fertilized (B6xCBA) F2 oocytes, which were implanted in pseudopregnant females.
|
Genotyping
HSL genotyping was as described (2). The presence of the human transgene was assessed by genomic Southern blotting with a 1.3 kb EcoRI-SstI fragment of phHSL(1.3) spanning nucleotides 1,263 to 260 bases 3' to the stop codon. On genomic EcoRI digests, the transgene generates a 5 kb fragment.
Organ weights of transgenic mice
Mice were maintained on Teklad Mouse Breeder Diet 8626 (Harlan, Madison, WI) and a 12 h light/dark cycle. At age 6 months, mice were killed after overnight fasting using pentobarbital sodium anesthesia, 6.5 µg/10 g body weight intraperitoneally (Somnotol; MTC Pharmaceuticals, Hamilton, Ontario, Canada). After cardiac puncture, organs were rapidly removed, weighed, and then frozen or used for cell isolation.
Leptin concentration
Plasma leptin levels was measured by ELISA (Mouse Leptin Quantikine ELISA Kit; R&D Systems, Minneapolis, MN) according to the manufacturer's recommendations.
Histology
Formol-fixed perigonadal fat fragments were embedded in paraffin. Tissue sections (5 µm) were stained with hematoxylin-phloxine-safran. Histological images were stored using the SPOT program (Diagnostic Instruments, Inc., Sterling Heights, MI) and analyzed with Image Pro software (Media Cybernetics, Carlsbad, CA). To determine cell diameter, points were randomly chosen in regions of good histological quality. Starting from these points, the maximal diameters was measured consecutively for 150200 cells in a centrifugal spiral excluding blood vessel and connective tissue cells. For each genotype, six or more nonoverlapping patches were studied (8001,000 adipocytes).
RNA quantification
Total RNA was extracted from perigonadal fat (Trizol; Gibco-Life Technologies, Burlington, Ontario, Canada). To increase yield, homogenates were incubated at 37°C for 10 min, then vortexed before continuing.
Total RNA served as the template for first-strand synthesis using poly(dT) primers and Superscript II reverse transcriptase (Invitrogen, Burlington, Ontario, Canada). For quantitative real-time PCR, we used the QuantiTect SYBR green PCR kit (Qiagen). Primers were as follows: GAGTTAAGTGGGCGCAAGTC and AAGTCCCTCAGGGTCAGGTT (exons 7 and 8, respectively) for human HSL mRNA; TGAGATGGTAACTGTGAGCC and ACTGAGATTGAGGTGCTGTC (exons 2 and 3) for mouse HSL mRNA; and ACGTTGACATCCGTAAAGACCT and GCAGTAATCTCCTTCTGCATCC for ß-actin mRNA, an internal control for RNA quantity. Each reaction yields 100 bp amplicons. PCR conditions were 15 s at 94°C, 20 s at 60°C, and 20 s at 72°C for 45 cycles. After amplification, a melting curve (0.01°C/s) was used to assess product purity.
Enzyme assays
HSL activity was assayed in vitro as neutral cholesteryl esterase using cholesteryl [1-14C]oleate and as TG hydrolase using glycerol tri[9,10(n)-3H]oleate (Amersham Biosciences, Baie d'Urfé, Quebec, Canada) as described (25) using fat-free infranatants of perirenal WAT from 2 month old mice. Protein concentration was estimated using the DC Protein Assay (Bio-Rad, Mississauga, Ontario, Canada).
Antibody production and Western blotting
For HSL, a N-terminal human HSL cDNA fragment encoding amino acids 1323 was cloned in pEt-30a(+) (Novagen, Madison, WI). Overexpression was stimulated by isopropyl ß-D-1-thiogalactopyranoside as described by the supplier. The expressed HSL fragment was isolated from the inclusion body of cultures incubated to an optical density of 0.6 using an affinity column recognizing the N-terminal histidine tag, as recommended by the company. The histidine tag was removed by enterokinase digestion. The HSL peptide was solubilized in 0.1 M Tris-Cl, pH 8.0, containing 0.1% L-sarcosine, 20% glycerol, and 10 mM 1,4-dithioerythritol. Polyclonal rabbit anti-HSL antibodies were produced (Clontech, Palo Alto, CA).
For Western blotting, fat-free infranatant proteins were used for SDS-PAGE. Western blotting was performed using a 1:8,000 dilution of anti-recombinant HSL serum. Bound antibody was detected by chemiluminescence (POD detection system; Roche) as recommended by the manufacturer. Signal intensity was estimated with ImageJ version 1.31 software (National Institutes of Health, Bethesda, MD).
Lipolysis in isolated adipocytes
Adipocytes were isolated between 9 and 10 AM from male mice with free access to food until the experiment, using collagenase digestion of 250 mg of perigonadal fat (26). Lipolysis was assayed as described (27), both in the nonstimulated (basal) state and in the presence of 10 µM CL316,243. Triplicate measurements were performed for each mouse. At least three mice of each genotype were tested. Lipolysis results were expressed as micromoles of glycerol per 106 cells per 2 h.
DG and TG measurements
Thirty milligrams of fat was homogenized in 2 ml of 0.9% NaCl and then extracted for 1 h with shaking in 20 ml of a mixture of chloroform-methanol (2:1) plus 4 ml of 0.9% NaCl. After centrifugation for 10 min at 2,000 g, the chloroform phase was removed and then evaporated under nitrogen. Lipids were resuspended in chloroform-methanol (2:1), and thin-layer chromatography was performed (Partisil K5; Whatman International Ltd., Maidstone, England) using hexane-ether-acetic acid (80:20:3) as the mobile phase. Scrapings of the TG and DG spots were extracted with chloroform-methanol (2:1) and quantified (TG GPO-PAP kit; Roche).
Data analysis
Comparisons were performed using the unpaired two-tailed Student's t-test. Distributions of adipocyte diameters were analyzed using GraphPad InStat software (GraphPad, San Diego, CA).
| RESULTS |
|---|
|
|
|---|
As reported previously in this strain of HSL/ mice (2), body mass in 6 month old males was significantly less in HSL/ (32.6 ± 0.4 g) than in HSL+/+ (39.9 ± 0.8 g) mice (P < 0.001) (Fig. 2). In HSL/N mice, body, mesenteric, and subcutaneous fat masses were not statistically different from normal, but perirenal and perigonadal fat masses were lower (P < 0.01) (Fig. 2; see supplementary table). HSL/ML mice resemble HSL/ mice in body mass (31.1 ± 1.1 g; P < 0.01) (Fig. 2A) and in intra-abdominal masses (perigonadal, perirenal, mesenteric; Fig. 2B) and subcutaneous inguinal WAT depot masses (Fig. 2C). In contrast, HSL/MH mice had a mixed profile, with perirenal and subcutaneous fat depot masses similar to those of HSL+/+ controls but lower perigonadal and mesenteric fat masses (P < 0.001). In females, body weights and fat masses followed similar patterns in relation to HSL genotype (Fig. 2FH).
|
WAT histology
As previously reported (2), the WAT of HSL/ mice shows more heterogeneity of cell size and increased interstitial volume than normal WAT (Fig. 3A, B). In perigonadal WAT, the modal cellular diameter in WAT from HSL/ mice (5560 µm; Fig. 3G) is less than that of HSL+/+ WAT (105110 µm; Fig. 3F). In HSL/N mice, WAT appears morphologically normal and the modal cell diameter is between 105 and 110 µm (Fig. 3C, H), although a small peak is identifiable at
50 µm as in HSL/ WAT. In contrast, both mutant transgenic strains resembled HSL/ WAT morphologically (Fig. 3D, E), with low modal cell diameters (HSL/ML, 6570 µm; HSL/MH, 5560 µm) (Fig. 3I, J) and a cell diameter profile resembling that of nontransgenic HSL/ mice.
|
|
TG and cholesteryl ester hydrolase assays
Cholesteryl esterase activity (Fig. 4F) was 1.6 ± 0.4% of normal in HSL/ WAT, 42 ± 9% in HSL/N, 50 ± 12% in HSL/ML, and 70 ± 16% in HSL/MH. Cholesteryl esterase activity was undetectable in testis in all HSL/ transgenic animals (data not shown). TG hydrolase activity in WAT (Fig. 4E) was 22 ± 8% of normal in nontransgenic HSL/ mice, versus 47 ± 15% in HSL/N mice, 54 ± 15% in HSL/ML mice, and 67 ± 12% in HSL/MH mice.
Lipolysis in isolated adipocytes
With ß-adrenergic stimulation, lipolysis in HSL/ adipocytes increased 1.6-fold, versus 18.0-fold in HSL+/+ adipocytes. For HSL/ transgenic adipocytes, mean enhancements were 8.1-fold in HSL/N, 2.7 in HSL/ML, and 3.7 in HSL/MH. Adrenergic-stimulated lipolysis in HSL/N cells attained 58% of the maximal rate measured in normal HSL+/+ cells.
DG and TG contents of WAT
WAT DG contents (Fig. 5A) fell into two groups, low and high. HSL+/+, HSL/N, and HSL/MH were similar, with 7.9 ± 2.5, 13.5 ± 1.7, and 14.8 ± 3.2 nmol/mg fat tissue, respectively. HSL/ and HSL/ML mice had significantly greater DG contents, 52.2 ± 5.1 and 56.2 ± 3.8 nmol/mg fat tissue, respectively. TG levels were not significantly different between strains (Fig. 5B). DG/TG ratios showed a similar pattern to total DG content (Fig. 5C).
|
| DISCUSSION |
|---|
|
|
|---|
Some technical considerations apply to comparisons between HSL/ mice expressing human HSL transgenes. First, measurements of endogenous mouse and transgenic human HSL mRNA and protein levels are not strictly equivalent because of potential differences in cDNA synthesis, PCR efficiency, and immunodetection with the anti-human HSL antibody. Comparison of enzymatic activities avoids these problems, but HSL/ mice have substantial background TG hydrolase activity (2, 3, 28) as a result of non-HSL lipase(s) in WAT (25). Because HSL provides the vast majority of adipocyte cholesteryl esterase activity (2), cholesteryl esterase assay provides a convenient measure of total HSL activity. These considerations apply to comparisons of wild-type controls and HSL/ human HSL transgenic animals. However, the effects of different human HSL transgenes on a HSL/ background can be compared directly (Fig. 4). Practical difficulties in obtaining large cohorts of HSL/ transgenic mice include the sterility of HSL/ males and the small fraction of same-sex HSL/ transgenic animals and nontransgenic HSL/ controls in litters.
On a HSL+/+ background, overexpression of normal or S554A HSL transgenes had no detectable effect on WAT mass or histology. For the normal transgene, this result is compatible with transfection studies of HSL in cultured cells, in which little change in TG content was observed except after massive overexpression of HSL (29). Also, Lucas et al. (30) observed in an independently derived transgenic HSL mouse line that expression of normal human HSL to a 3-fold higher level of HSL activity than in wild-type controls had little detectable impact on adipocyte physiology. In S554A HSL+/+ mice, the lack of a detectable WAT phenotype argued against a physiologically important activation of HSL by this mutation. However, to study their effects in the absence of endogenous HSL, we bred each of the three transgenes to a HSL/ background.
The data in transgenic HSL/ mice are relevant to at least six aspects of adipocyte physiology. First, the results prove that normal human HSL is physiologically active in mouse adipocytes. In HSL/ mice, the expression of human HSL dramatically improves WAT mass, cell size distribution, DG content, and lipolytic response to adrenergic stimulation. In HSL/N mice, this occurred despites subnormal levels of HSL mRNA, protein, and activity, ranging from
13% to 40% of normal endogenous HSL levels. Of note, heterozygous HSL+/ mice, which have half-normal levels of HSL protein, mRNA, and activity, have normal WAT mass and histology and approximately half the ß-adrenergic stimulated increase of lipolysis observed in HSL+/+ adipocytes (2). The slightly increased prevalence of small cells in HSL/N WAT (Fig. 3) suggests that HSL levels in these mice may approach the threshold below which the typical pathology of HSL/ WAT develops. These observations imply that despite the multiple deletions/insertions by which human and mouse HSL differ (23), human HSL is functional in mouse adipocytes. By extension, the in vivo interaction of human HSL with the mouse orthologs of its protein partners (18, 19) and translocation to the lipid droplet surface can occur.
Second, contrary to initial predictions, the expression of S544A HSL on the HSL/ background had little effect on WAT histology or lipolysis in intact adipocytes, despite the presence of HSL immunoreactive material and in vitro catalytic activity (Fig. 4) at least as great as those of the wild-type HSL transgene that markedly improved WAT function and anatomy. Interestingly, there were differences between the two mutant transgenic lines. MH mice, with a higher transgene copy number, HSL mRNA, and protein levels, had nearly normal DG content and WAT masses in perirenal and subcutaneous WAT. However, the masses of other fat depots, WAT histology in all depots, and adipocyte lipolysis resemble those of HSL/ and HSL/ML WAT. Biological differences among WAT adipose depots are increasingly documented (3133), but the mechanism in the case of HSL/MH mice is not apparent. Perhaps the expression of S554A HSL at higher levels than those of HSL/MH mice might correct the WAT phenotype of HSL/ mice.
The low physiological activity of S554A HSL could potentially arise from differences in HSL phosphorylation at activating serine residues and/or from disturbed interactions of HSL with other molecules of the lipid droplet surface (34), including perilipin, which is thought to determine access to droplet TGs (3538). Of note, during the preparation of this article, Su et al. (21) provided a potential explanation for this finding. They studied different HSL mutations using FLAG-tagged rat HSL in 3T3-L1 cells. In that study, S565A HSL, orthologous to S554A in human HSL, did not translocate to the lipid droplet. Together, these observations are consistent with the notion that S554A HSL and its rat ortholog may directly affect the translocation of HSL to the lipid droplet surface.
Third, the WAT pathology of HSL/ mice appears to be mainly cell autonomous, because it is selectively corrected by HSL expression in adipocytes. This was not previously clear: HSL deficiency is a multisystemic endocrinopathy in which observed abnormalities in WAT could plausibly result either directly from HSL deficiency in WAT or indirectly from abnormalities of other HSL-deficient organs. Of note, the transgenic aP2 promoter also mediates low-level expression in macrophages (39, 40). Surprisingly, in transgenic mice, HSL overexpression in macrophages is associated with increased atherosclerosis (41). The effect, if any, of macrophage HSL expression on the WAT phenotype of transgenic HSL/ mice cannot be deduced at present. Of note, however, transgenic HSL expression in the mice described in this study had little apparent effect on HSL deficiency in other organs (Fig. 2D). It will now be possible to specifically explore the function of nonadipose HSL-deficient tissues, such as pancreatic ß cells, using HSL/ mice with normal or nearly normal HSL function in WAT.
Fourth, leptin levels were roughly proportional to fat masses (Fig. 2E), with no obvious relationship to HSL genotype or to the presence of typical WAT pathology. This suggests that HSL deficiency does not directly affect leptin production except by influencing total WAT mass.
Fifth, a WAT HSL isoform identical to the major isoform except for an additional 43 residue N-terminal extension accounts for
15% of HSL transcripts in mouse WAT (42) and apparently predominates in pancreatic ß cells (5). Its properties have not been studied exhaustively. However, it is apparently not essential for WAT function, because expression of the major HSL isoform alone can normalize the properties of HSL/ WAT.
Finally, HSL has greater specific activity toward DGs than TGs (43), and HSL/ WAT has a marked selective increase of DG content (28). HSL/MH mice have normal DG content in WAT but abnormal adrenergic-stimulated lipolysis and WAT histology similar to nontransgenic HSL/ mice. Therefore, the increased DG content that accompanies total HSL deficiency is not essential for the development of the WAT pathology of HSL/ mice.
| ACKNOWLEDGMENTS |
|---|
Manuscript received February 28, 2005 and in revised form May 23, 2005.
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Journal of Biological Chemistry |
| Molecular and Cellular Proteomics | ASBMB Today |