Advertisement
J. Lipid Res.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1194/jlr.M600136-JLR200 on August 22, 2006

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M600136-JLR200v1
47/11/2408    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brundert, M.
Right arrow Articles by Rinninger, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brundert, M.
Right arrow Articles by Rinninger, F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Journal of Lipid Research, Vol. 47, 2408-2421, November 2006
Copyright © 2006 by American Society for Biochemistry and Molecular Biology

Selective uptake of HDL cholesteryl esters and cholesterol efflux from mouse peritoneal macrophages independent of SR-BI

May Brundert*, Joerg Heeren*, Mukaddes Bahar-Bayansar*, Anne Ewert*, Kathryn J. Moore{dagger} and Franz Rinninger1,*

* University Hospital Hamburg Eppendorf, 20246 Hamburg, Germany
{dagger} Harvard Medical School, Massachusetts General Hospital, Boston, MA 02114

Published, JLR Papers in Press, August 22, 2006.

1 To whom correspondence should be addressed. e-mail: rinninger{at}uke.uni-hamburg.de


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Scavenger receptor class B type I (SR-BI) mediates the selective uptake of HDL cholesteryl esters (CEs) and facilitates the efflux of unesterified cholesterol. SR-BI expression in macrophages presumably plays a role in atherosclerosis. The role of SR-BI for selective CE uptake and cholesterol efflux in macrophages was explored. Macrophages and HDL originated from wild-type (WT) or SR-BI knockout (KO; homozygous) mice. For uptake, macrophages were incubated in medium containing 125I-/3H-labeled HDL. For lipid removal, [3H]cholesterol efflux was analyzed using HDL as acceptor. Selective uptake of HDL CE ([3H]cholesteryl oleyl ether – 125I-tyramine cellobiose) was similar in WT and SR-BI KO macrophages. Radiolabeled SR-BI KO-HDL yielded a lower rate of selective uptake compared with WT-HDL in WT and SR-BI KO macrophages. Cholesterol efflux was similar in WT and SR-BI KO cells using HDL as acceptor. SR-BI KO-HDL more efficiently promoted cholesterol removal compared with WT-HDL from both types of macrophages. Macrophages selectively take up HDL CE independently of SR-BI. Additionally, in macrophages, there is substantial cholesterol efflux that is not mediated by SR-BI. Therefore, SR-BI-independent mechanisms mediate selective CE uptake and cholesterol removal. SR-BI KO-HDL is an inferior donor for selective CE uptake compared with WT-HDL, whereas SR-BI KO-HDL more efficiently promotes cholesterol efflux.

Supplementary key words high density lipoprotein • scavenger receptor class B type I • reverse cholesterol transport


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HDL levels in plasma are inversely related to the risk of atherosclerosis in humans (1). A physiological role of HDL in cholesterol homeostasis in vivo is established (2). HDL and its precursors presumably remove cholesterol from peripheral tissues. After esterification in plasma, HDL-associated cholesteryl esters (CEs) are delivered to other lipoprotein fractions (3) or tissues (4). One mechanism that mediates the direct delivery of HDL CE to organs is the selective lipid uptake pathway (4). In this process, HDL CEs are internalized by cells independently of the uptake of HDL holoparticles. Physiologically, this lipid uptake appears to be important for the delivery of cholesterol to steroidogenic tissues for hormone synthesis and to the liver for disposal via bile (4).

Scavenger receptor class B type I (SR-BI) is a cell surface receptor that mediates selective HDL CE uptake in cultured cells (5). In rodents, SR-BI is most abundantly expressed in liver and in steroidogenic organs (5), which are the tissues most actively engaged in selective HDL lipid uptake in vivo (4). The role of SR-BI in HDL metabolism was addressed in vivo (6–8). In mice with a targeted homozygous null mutation in the gene encoding SR-BI (SR-BI KO), plasma HDL cholesterol is increased and no selective HDL CE uptake by the liver is observed; in contrast, substantial hepatic selective CE uptake is detected in wild-type (WT) littermates (7, 8). Together, this evidence suggests that SR-BI is a receptor that mediates HDL selective CE uptake in vivo.

Distinct from lipid internalization, SR-BI has a function in cellular cholesterol removal as well. In Chinese hamster ovary cells, SR-BI may facilitate HDL-mediated cholesterol efflux (9). Cholesterol removal rates correlate closely with SR-BI expression levels in these cells. Therefore, a dual function of SR-BI in lipid homeostasis was suggested (i.e., it facilitates the efflux of unesterified cholesterol and mediates the uptake of HDL-associated CE) (2).

Macrophages are detected in atherosclerotic lesions of the vessel wall, and cholesterol accumulation leads to their conversion to foam cells (10). HDL selective CE uptake (11, 12) and more recently SR-BI expression (9, 13) by macrophages have been established. The dominant function of SR-BI in arterial wall macrophages (i.e., to mediate the uptake of HDL-associated CE or facilitate the efflux of unesterified cholesterol) is controversial at present. In bone marrow transplantation studies in mice, macrophage SR-BI expression protected the vessel wall from atherosclerosis (14–16). In contrast, an SR-BI deficiency was associated with an increased atherosclerotic lesion area in the murine aorta (17). These studies provide evidence for a role of macrophage SR-BI expression in the pathogenesis of atherosclerosis.

Besides the function of SR-BI in cellular lipid metabolism, the expression of this receptor has a substantial impact on the composition of HDL particles in plasma (6). HDL from SR-BI-deficient mice is enriched in unesterified cholesterol and contains more apolipoprotein E (apoE) compared with HDL from WT rodents (6, 7, 17–19). Additionally, SR-BI KO-HDL particles have on average a larger diameter compared with WT-HDL (6, 18).

In this study, the role of SR-BI in macrophage cholesterol homeostasis was explored. Macrophages and HDL originated from SR-BI KO (homozygous) and WT mice (6). Initially, the question was addressed whether cellular HDL selective CE uptake can be detected in the absence of SR-BI expression. Additionally, the contribution of SR-BI to cellular cholesterol efflux was investigated. These studies explore the issue of whether macrophages have a mechanism that mediates selective HDL CE uptake and efflux of cholesterol that is independent from SR-BI. Because the composition of WT-HDL and of SR-BI KO-HDL are substantially different, both HDL fractions were evaluated as donors for selective CE uptake and as acceptors for cellular cholesterol (6, 17). The results provide evidence for a mechanism distinct from SR-BI that mediates selective HDL lipid uptake by macrophages. Also, an SR-BI-independent mechanism promotes cholesterol efflux. A surprising result was that SR-BI KO-HDL yields substantial differences in CE uptake and cholesterol efflux in macrophages compared with WT-HDL.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice
Mice with a targeted null mutation in the SR-BI gene (SR-BI KO; SR-BI–/–) or the CD36 gene (CD36 KO; CD36–/–) and their respective WT littermates were described previously (6, 7, 20). Only WT or homozygous mutant animals were used in this study. All protocols were approved by the local committee on laboratory animal care.

Lipoprotein preparation
HDL (d = 1.063–1.21 g/ml) was isolated from WT murine plasma (WT-HDL) and in parallel from SR-BI KO murine plasma (SR-BI KO-HDL) by sequential ultracentrifugation (7). HDL3 (d = 1.125–1.21 g/ml), LDL (d = 1.019–1.05 g/ml), and acetylated LDL (acetyl-LDL) were prepared from human plasma (21, 22). HDL and HDL3 were labeled with 125I-tyramine cellobiose (125I-TC) and [3H]cholesteryl oleyl ether ([3H]CEt; Amersham) (23).

Mouse peritoneal macrophages
Macrophages were collected from WT, SR-BI KO, or CD36 KO mice 3 days after an intraperitoneal injection of thioglycollate (3.85%, 1.0 ml) (24, 25). Cells were plated onto six-well dishes (Nunc) at 3 x 106 cells/well in DMEM (Life Technologies) containing FBS (10%; Life Technologies), penicillin (50 IU/ml), streptomycin (50 µg/ml), and glutamine (2 mM). Four hours after plating, nonadherent cells were removed by washing in PBS (1x). Macrophages were cultured (37°C, 24 h) in DMEM containing FBS, antibiotics, and glutamine (see above). Finally, this medium was aspirated, the cells were washed, and the medium was replaced by DMEM containing BSA (5 mg/ml), antibiotics, and glutamine (see above). Cells were cultured at 37°C in this medium for 24 h.

BHK cells
BHK cells were transfected with the plasmid pBK-CMV-hSR-BI containing the full-length human SR-BI cDNA or with the respective vector (pBK-CMV; Stratagene) (26).

Preincubation of the cells
Before initiating the assays, cells were preincubated (37°C, 30 min) in serum-free and lipoprotein-free medium (21). These preincubations were done to allow internalization or dissociation of membrane-associated serum or protein components originating from culture or from cell secretion. After aspiration of the medium, the cells were washed in PBS (2x). Thereafter, preincubation was performed (37°C, 30 min) in DMEM containing BSA (5 mg/ml) and antibiotics (see above).

Uptake of doubly radiolabeled HDL by macrophages and BHK cells
Cells were incubated at 37°C in DMEM containing BSA (5 mg/ml) and the respective 125I-TC-/[3H]CEt-labeled HDL; the lipoprotein concentrations and incubation times are indicated in the figure legends (21). After these incubations, the medium was aspirated and the cells were washed in PBS (4x). Then DMEM containing BSA (5 mg/ml) and unlabeled human HDL3 (100 µg HDL3/ml) was added for a "chase" incubation (37°C, 2.0 h) to remove reversibly cell-associated tracers (21). After this chase period, the medium was aspirated and the cells were washed again in PBS (1x). The cells were then released from the wells with trypsin/EDTA solution (0.5 g/l trypsin and 0.2 g/l EDTA; 1.0 ml/well). Trypsin activity was quenched by the addition of PBS supplemented with excess BSA (50 mg/ml, 4°C). The cell suspensions were transferred to tubes with a PBS (4°C) rinse of the wells. The cells then were pelleted by centrifugation (2,000 g, 4°C, 15 min) followed by aspiration of the supernatant. Thereafter, the pellet was resuspended in PBS (4°C, 5.0 ml) followed by centrifugation (2,000 g, 4°C, 15 min). The final cell pellet was dissolved in NaOH solution (0.1 N, 1.0 ml) and sonicated, and aliquots were used for protein determination (27), direct 125I radioassay, and 3H liquid scintillation counting after lipid extraction (21).

[3H]cholesterol efflux from macrophages
Macrophages were incubated (37°C, 24 h) in DMEM supplemented with [3H]cholesterol (0.5 µCi/ml; New England Nuclear), FBS, antibiotics, and glutamine (see above) (24). After labeling, the cells were equilibrated overnight in DMEM containing BSA (5 mg/ml) and antibiotics (see above). After labeling and equilibration, macrophages were washed with PBS (1x). This was followed by incubation (37°C) in DMEM containing BSA (5 mg/ml), murine HDL, human HDL3, or purified delipidated human apoA-I (4). At the indicated time intervals, 55 µl of medium was taken, and after precipitation at 6,000 g for 10 min to remove cell debris and cholesterol crystals, radioactivity in a 50 µl aliquot of supernatant was determined by scintillation counting. Finally, the cells were lysed in NaOH solution and the radioactivity of an aliquot was determined. Cholesterol efflux is expressed as percentage of the radioactivity released from cells into the medium relative to the total radioactivity in cells and medium (24).

125I-TC-HDL binding to macrophages
Briefly, after chilling (4°C) and washing (PBS, 4°C), macrophages were incubated (4°C, 2.0 h) in DMEM (pH 7.4) containing BSA (5 mg/ml), HEPES (10 mM), and the indicated concentration of 125I-TC-HDL (28). Thereafter, the cells were washed with PBS (4°C) and digested with NaOH solution (0.1 M). Aliquots of the suspension were assayed for 125I radioactivity and for protein (27).

Immunoblot analysis
Postnuclear supernatants were prepared from cells (26). These samples or HDL were fractionated by SDS-PAGE (10%) under reducing conditions. Thereafter, the proteins were transferred to nitrocellulose membranes. Finally, the membranes were incubated in buffer containing an anti-mouse SR-BI antiserum (29), an anti-mouse CD36 antiserum (30), or specific antibodies directed against murine apoA-I (Biodesign), apoE (Acris), or ß-actin (Biodesign). IgG binding was detected using a peroxidase-conjugated goat anti-rabbit IgG (Amersham). Antibody binding was visualized by ECL detection (Amersham) and autoradiography.

Miscellaneous
Briefly, in some cases, cholesterol, phospholipid, and triglyceride were measured with enzymatic assays (Roche) and protein was analyzed as described (27). In other cases, the cholesterol content of macrophage lipid extracts was determined using the Amplex Red Cholesterol Kit (Invitrogen) and protein was analyzed with the Micro BCA Kit (Pierce).

Total mRNA was extracted from cells using the NucleoSpin II Kit (Macherey-Nagel). To obtain cDNA, reverse transcription was performed using oligo(dT) primer, polymerase, and RNase inhibitor according to the manufacturer's recommendations. PCR was performed using the following primers (SR-BI forward, GGCGCATAAAGCCTCTGGCCAC; SR-BI reverse, CGGGTCTATGCGGACATTCTTGAGC; ß2-microglobulin forward, GGCCTGTATGCTATCCAGAA; ß2-microglobulin reverse, TGCAGGCGTATGTATCAGTC). Standard cycle conditions were 95°C for 10 min, followed by 35 cycles of 95°C for 30 s, 66°C for 1 min (ß2-microglobulin) or 70°C for 1 min (SR-BI), and 72°C for 1 min. PCR products (SR-BI, 315 bp; ß2-microglobulin, 252 bp) were separated on agarose gels.

HDL was analyzed by nondenaturing polyacrylamide gradient gel (4–15%) electrophoresis, and HDL size was estimated by comparison with standard proteins (31).

Statistics and calculations
Values shown are means ± SEM. Student's t-test was used to calculate significance.

125I-TC-/[3H]CEt-labeled HDL uptake by cells is shown in terms of apparent HDL particle uptake, expressed as HDL protein (4, 21). This is done to compare the uptake of both tracers on a common basis. The uptake of HDL holoparticles is represented by equal uptake of both tracers. The difference in uptake between [3H]CEt and 125I-TC yields the apparent selective HDL CE uptake.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
WT and SR-BI KO mice
Peritoneal macrophages and lipoproteins originated from SR-BI KO (homozygous) mice or from their WT littermates (6, 7). In WT mice, total plasma cholesterol was 98.5 ± 3.6 mg/dl, and in SR-BI KO animals, the respective value was 190.5 ± 7.7 mg/dl (n = 17 mice; P < 0.0001). This increase in total cholesterol in SR-BI KO mice is primarily attributable to an increase in HDL cholesterol (data not shown) (7).

Size and composition of unlabeled and doubly radiolabeled murine HDL
HDL was isolated in parallel from plasma from WT and SR-BI KO mice and thereafter radiolabeled in the protein moiety with 125I-TC and in the lipid moiety with [3H]CEt (23).

HDL particle size was estimated by nondenaturing polyacrylamide gel electrophoresis (Fig. 1A , B) (31). Migration of unlabeled and radiolabeled SR-BI KO-HDL was slower than that of WT-HDL, indicating a larger apparent particle size. This increase in the size of SR-BI KO-HDL is consistent with previous studies (6, 18).


Figure 1
View larger version (31K):
[in this window]
[in a new window]
  		Fig. 1. HDL analysis by nondenaturing polyacrylamide gradient gel electrophoresis and immunoblots. A, B: Unlabeled (10 µg; A) and doubly radiolabeled (14 µg; B) wild-type (WT)-HDL and scavenger receptor class B type I (SR-BI) knockout (KO)-HDL were subjected to nondenaturing polyacrylamide gradient gel electrophoresis. The migration positions of standard proteins (nm) are shown (arrows). Two independent experiments yielded qualitatively identical results. C, D: Unlabeled (C) and doubly radiolabeled (B) WT-HDL and SR-BI KO-HDL were immunoblotted using apolipoprotein E (apoE)- and apoA-I-specific antibodies. In C, 5 µg of HDL protein (for apoE) and 0.2 µg HDL protein (for apoA-I) were loaded. In D, 1.7 µg of HDL protein (for apoE) and 0.2 µg of HDL protein (for apoA-I) were loaded. Three independent experiments yielded qualitatively identical results. Asterisks indicate that no sample was loaded. CEt, cholesteryl oleyl ether; TC, tyramine cellobiose.

 
The chemical analysis of WT-HDL and SR-BI KO-HDL revealed for unlabeled and radiolabeled SR-BI KO-HDL an enrichment in cholesterol compared with WT-HDL (Table 1 ) (7). This increase in total cholesterol is primarily attributable to an increment of unesterified cholesterol (7, 17–19). The protein composition of both HDL preparations was analyzed on immunoblots (Fig. 1C, D). SR-BI KO-HDL contained substantially more apoE compared with WT-HDL, and this observation is consistent with previous studies (6, 18). ApoA-I was detected in similar quantities in WT-HDL and SR-BI KO-HDL.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Chemical composition of HDL preparations

 
SR-BI mRNA and protein expression of macrophages
SR-BI mRNA levels and SR-BI protein expression of macrophages isolated from WT or SR-BI KO mice were examined (Fig. 2 ). SR-BI mRNA was detected in macrophages from WT mice using conventional RT-PCR, whereas no expression was measurable in cells from SR-BI KO animals (Fig. 2A). Similar expression levels were detected for the reference gene (i.e., ß2-microglobulin) in both groups of cells. To explore SR-BI protein expression, postnuclear supernatants from WT and SR-BI KO macrophages were immunoblotted using an SR-BI-specific antiserum (Fig. 2B) (29). In WT cells, a signal corresponding to SR-BI was detected. In contrast, in proteins originating from mutant macrophages, the respective band was not visible. Transfected BHK cells with high SR-BI expression served as a positive control (Fig. 2B) (26). In summary, SR-BI is expressed in WT macrophages, based on mRNA and protein detection (32).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		Fig. 2. SR-BI mRNA levels and immunoblot analysis for SR-BI in macrophages from WT or SR-BI KO mice and in BHK cells. Macrophages were prepared from WT or SR-BI KO mice, and BHK cells with SR-BI expression were generated as described in Materials and Methods. A: Expression of SR-BI and ß2-microglobulin (beta-2-MG) mRNA was determined by RT-PCR. Shown are results from one representative experiment from a total of three. B: Postnuclear supernatants were prepared, and the indicated protein mass was fractionated by SDS-PAGE (10%). After transfer to nitrocellulose, the proteins were immunoblotted with an anti-SR-BI antiserum as described in Materials and Methods. Two similar blots yielded qualitatively identical results. MW, molecular mass.

 
Uptake of murine HDL by macrophages
To investigate lipoprotein uptake, macrophages were incubated in medium containing 125I-TC-/[3H]CEt-labeled HDL (4, 21). Then, cellular internalization of HDL tracers was analyzed and expressed in terms of apparent HDL particle uptake. Selective CE uptake from HDL by cells is calculated as the difference in apparent HDL particle uptake between [3H]CEt and 125I-TC.

Dose-response curves for HDL uptake by macrophages are shown in Fig. 3 . WT cells were incubated in medium containing 125I-TC-/[3H]CEt-WT-HDL (Fig. 3A). Uptake of HDL-associated 125I-TC and [3H]CEt increased in a dose-dependent manner (data not shown). As expected, apparent HDL particle uptake attributable to [3H]CEt was in excess of that attributable to 125I-TC; the difference in uptake between both tracers yields the apparent selective CE uptake, and this is presented in Fig. 3A. This selective CE uptake increased in an HDL concentration-dependent manner. In this experiment (Fig. 3A), from total cellular [3H]CEt uptake, only 3.9% to 6.0% were internalized via HDL holoparticle internalization as represented by 125I-TC (4). In parallel, WT macrophages were incubated in the presence of 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 3A). Also in this case, a dose-dependent increase in selective CE uptake ([3H]CEt – 125I-TC) was detected, although the respective rate was significantly lower compared with radiolabeled WT-HDL in WT cells.


Figure 3
View larger version (8K):
[in this window]
[in a new window]
  		Fig. 3. Dose-response curves for selective cholesteryl ester (CE) uptake from 125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL by WT or SR-BI KO macrophages. Macrophages from WT (A) and SR-BI KO (B) mice were incubated (37°C, 4.0 h) in DMEM containing 125I-TC-/[3H]CEt-WT-HDL or 125I-TC-/[3H]CEt-SR-BI KO-HDL; the respective HDL concentrations are given on the abscissae. Then, cellular tracer content and apparent HDL particle uptake (125I-TC, [3H]CEt) were analyzed, and apparent selective HDL CE uptake ([3H]CEt – 125I-TC) was calculated. Values are means ± SEM of three independent incubations. Where no error bars are shown, the SEMs were smaller than the respective symbols. For A, * P = 0.0007, ** P = 0.0014, *** P = 0.0086, **** P = 0.0001; for B, * P = 0.0045, ** P = 0.0071, *** P = 0.0064, **** P = 0.0026. Two independent similar experiments yielded qualitatively identical results.

 
Additionally, macrophages from SR-BI KO mice were incubated in medium containing either 125I-TC-/[3H]CEt-WT-HDL or 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 3B). In the presence of 125I-TC-/[3H]CEt-WT-HDL, selective HDL CE uptake increased in a dose-dependent manner. Selective lipid uptake from 125I-TC-/[3H]CEt-SR-BI KO-HDL by SR-BI KO macrophages was lower compared with that from 125I-TC-/[3H]CEt-WT-HDL (Fig. 3B). Remarkably, all rates for HDL selective CE uptake were similar in WT and SR-BI KO macrophages (i.e., in cells with or without SR-BI expression) (Fig. 3).

Kinetics for macrophage HDL uptake are presented in Fig. 4 . WT macrophages were incubated in medium containing 125I-TC-/[3H]CEt-WT-HDL, and selective CE uptake ([3H]CEt – 125I-TC) increased in a time-dependent manner (Fig. 4A). In parallel, WT macrophages were incubated in the presence of 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 4A). Under these conditions as well, a time-dependent increase in HDL selective CE uptake ([3H]CEt – 125I-TC) was observed, although the respective rate was significantly lower compared with selective lipid uptake from 125I-TC-/[3H]CEt-WT-HDL by WT macrophages.


Figure 4
View larger version (6K):
[in this window]
[in a new window]
  		Fig. 4. Kinetics for selective CE uptake from 125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL by WT or SR-BI KO macrophages. Macrophages from WT (A) and SR-BI KO (B) mice were incubated (37°C, 10 min, 1.0 h, 2.0 h, or 4.0 h) in medium containing 125I-TC-/[3H]CEt-WT-HDL (20 µg HDL protein/ml) or 125I-TC-/[3H]CEt-SR-BI KO-HDL (20 µg HDL protein/ml). Then, cellular tracer content and apparent HDL particle uptake (125I-TC, [3H]CEt) were analyzed, and apparent selective CE uptake ([3H]CEt – 125I-TC) was calculated as described in Materials and Methods. Values are means ± SEM of three (A) or two (B) incubations. In A, where no error bars are shown, the SEMs were smaller than the respective symbols. In B, variation from the mean was <8%. For A, * P = 0.02, ** P = 0.004, *** P = 0.0003, **** P < 0.0001. Two independent similar experiments yielded qualitatively identical results.

 
In parallel, macrophages from SR-BI KO mice were incubated in medium containing 125I-TC-/[3H]CEt-WT-HDL or 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 4B). Also in these cases, a time-dependent increase in selective HDL CE uptake ([3H]CEt – 125I-TC) was detected. Radiolabeled SR-BI KO-HDL yielded a lower rate of selective CE uptake compared with labeled WT-HDL in SR-BI KO macrophages. Again, the macrophage SR-BI deficiency was associated with similar rates of selective HDL CE uptake compared with cells with SR-BI expression (Fig. 4A vs. B).

Regulation of HDL selective CE uptake
Macrophages were cultured under cholesterol-poor conditions in this study. Cholesterol deprivation upregulates HDL selective CE uptake by macrophages (12). The possibility was considered that the results shown in Figs. 3 and 4 were observed exclusively under these experimental conditions. To investigate regulation, WT or SR-BI KO macrophages were cultured in the absence or presence of acetyl-LDL to increase cell cholesterol (Fig. 5 ) (22). In WT cells incubated without acetyl-LDL, cell cholesterol was 42.7 µg/mg cell protein; in the presence of acetyl-LDL, the respective value increased to 70.3 µg/mg cell protein.


Figure 5
View larger version (13K):
[in this window]
[in a new window]
  		Fig. 5. Regulation of selective CE uptake from 125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL by macrophages prepared from WT or SR-BI KO mice. Macrophages from WT (A) and SR-BI KO (B) mice were incubated (37°C, 20 h) in medium in the absence or presence of acetylated LDL (acetyl-LDL; 50 µg protein/ml). Preincubation (37°C, 0.5 h) was followed by incubation (37°C, 4.0 h) in medium containing 125I-TC-/[3H]CEt-WT-HDL (40 µg HDL protein/ml) or 125I-TC-/[3H]CEt-SR-BI KO-HDL (40 µg HDL protein/ml). Then, cellular tracer content and apparent HDL particle uptake (125I-TC, [3H]CEt) were analyzed. Shown is apparent selective HDL CE uptake (i.e., the difference between [3H]CEt and 125I-TC). Values are means ± SEM of three incubations. One independent similar experiment yielded qualitatively identical results.

 
After the loading period, macrophages were incubated in medium containing 125I-TC-/[3H]CEt-WT-HDL or 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 5). In WT cells, acetyl-LDL loading decreased selective HDL CE uptake ([3H]CEt – 125I-TC), and this was true for 125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 5A). Analogously, in SR-BI KO macrophages, cholesterol loading decreased selective HDL CE uptake ([3H]CEt – 125I-TC) using both 125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL as lipoprotein preparations (Fig. 5B).

Selective HDL CE uptake by cells with high SR-BI expression
125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL yield substantial differences in rates of selective CE uptake in macrophages. However, in this model, SR-BI expression is lower compared with other cell types (Fig. 2B). Therefore, the issue was addressed whether the different rates of selective CE uptake from WT-HDL and SR-BI KO-HDL in macrophages were unique to this experimental model. Additionally, the question was raised whether radiolabeled WT-HDL and SR-BI KO-HDL interact similarly or differently with SR-BI. Stably transfected BHK cells with very high SR-BI expression and control BHK cells (vector) with no detectable SR-BI were incubated in parallel in medium containing 125I-TC-/[3H]CEt-WT-HDL or 125I-TC-/[3H]CEt-SR-BI KO-HDL (Fig. 6 ) (26). In control BHK cells, 125I-TC-/[3H]CEt-WT-HDL yielded a higher rate of selective CE uptake ([3H]CEt – 125I-TC) compared with 125I-TC-/[3H]CEt-SR-BI KO-HDL. In BHK cells with high SR-BI expression, HDL selective CE uptake increased compared with that in control BHK cells (Fig. 6). However, also in these BHK cells, selective CE uptake from 125I-TC-/[3H]CEt-WT-HDL was in excess of uptake from 125I-TC-/[3H]CEt-SR-BI KO-HDL. Thus, irrespective of cellular SR-BI expression and in independent experimental models, SR-BI KO-HDL yields a lower rate of selective CE uptake.


Figure 6
View larger version (15K):
[in this window]
[in a new window]
  		Fig. 6. Selective CE uptake from 125I-TC-/[3H]CEt-WT-HDL and 125I-TC-/[3H]CEt-SR-BI KO-HDL by BHK cells without or with SR-BI expression. Control BHK cells (vector) or BHK cells with SR-BI expression were incubated (37°C, 4.0 h) in medium containing 125I-TC-/[3H]CEt-WT-HDL (40 µg HDL protein/ml) or 125I-TC-/[3H]CEt-SR-BI KO-HDL (40 µg HDL protein/ml). Then, cellular tracer content and apparent HDL particle uptake were analyzed. Apparent HDL selective CE uptake was calculated as the difference in apparent particle uptake between [3H]CEt and 125I-TC. Values are means ± SEM of three incubations. One independent identical and one independent similar experiment yielded qualitatively identical results.

 
Cholesterol efflux from macrophages
To explore the role of SR-BI for lipid efflux, cell cholesterol of WT and SR-BI KO macrophages was radiolabeled with [3H]cholesterol (9, 24). Then, a [3H]cholesterol efflux assay was initiated in the presence of WT-HDL or SR-BI KO-HDL as lipid acceptor.

In HDL dose-response curves for [3H]cholesterol efflux from WT macrophages, WT-HDL promoted a dose-dependent increase in [3H]cholesterol removal (Fig. 7A ). Qualitatively identical, SR-BI KO-HDL facilitated a dose-dependent lipid efflux as well, although the respective rate was quantitatively significantly higher compared with WT-HDL in these WT cells. In macrophages from SR-BI KO mice, [3H]cholesterol efflux was also explored (Fig. 7B). Lipid removal from these SR-BI-deficient macrophages was quantitatively similar compared with that in WT cells; again, SR-BI KO-HDL more efficiently stimulated [3H]cholesterol efflux from these SR-BI-deficient macrophages.


Figure 7
View larger version (6K):
[in this window]
[in a new window]
  		Fig. 7. [3H]cholesterol efflux from WT and SR-BI KO macrophages, and dose-response curves for WT-HDL and SR-BI KO-HDL. The cell cholesterol of macrophages isolated from WT (A) and SR-BI KO (B) mice was labeled with [3H]cholesterol. Then, macrophages were incubated (37°C, 5.0 h) in medium containing WT-HDL or SR-BI KO-HDL; the respective HDL concentrations are indicated on the abscissae. [3H]cholesterol efflux was analyzed as described in Materials and Methods. Values are means ± SEM of three incubations. Where no error bars are shown, the SEMs were smaller than the respective symbols. For A, * P = 0.0002, ** P = 0.008, *** P = 0.002; for B, * P = 0.003, ** P = 0.007, *** P = 0.03. Two independent similar experiments yielded qualitatively identical results.

 
Human HDL3 as donor for selective CE uptake and as acceptor for cell cholesterol
Human HDL is frequently used to investigate cholesterol homeostasis of murine macrophages (11, 14–16, 25). Therefore, selective CE uptake from human 125I-TC-/[3H]CEt-HDL3 by murine WT and by SR-BI KO macrophages was explored (Fig. 8 ). In WT macrophages, uptake of both 125I-TC and [3H]CEt increased in a dose-dependent manner, and the difference ([3H]CEt – 125I-TC) yielded a dose-dependent apparent selective CE uptake from HDL3 (Fig. 8A). In SR-BI KO macrophages, 125I-TC-/[3H]CEt-HDL3 yielded a dose-dependent increase in apparent selective CE uptake as well, and the respective rate was not significantly different from that of WT cells (Fig. 8B).


Figure 8
View larger version (7K):
[in this window]
[in a new window]
  		Fig. 8. Uptake of human 125I-TC-/[3H]CEt-HDL3 by WT or SR-BI KO macrophages. Macrophages from WT (A) and SR-BI KO (B) mice were incubated (37°C, 4.0 h) in medium containing human 125I-TC-/[3H]CEt-HDL3; the respective HDL3 concentrations are given on the abscissae. Then, cellular tracer content and apparent HDL3 particle uptake were analyzed. 125I represents apparent HDL3 particle uptake according to 125I-TC-labeled protein; [3H] demonstrates apparent particle uptake attributable to [3H]CEt; and [3H]–125I shows the difference (i.e., apparent selective CE uptake). Values are means ± SEM of three independent incubations. Where no error bars are shown, the SEMs were smaller than the respective symbols. For selective uptake: a P = 0.23, b P = 0.86, c P = 0.53, d P = 0.059, e P = 0.15. One independent experiment yielded qualitatively identical results.

 
Using human HDL3 and human apoA-I as sterol acceptors, [3H]cholesterol efflux from murine WT and SR-BI KO macrophages was investigated. Dose-response curves for cellular [3H]cholesterol efflux with HDL3 as lipid acceptor are presented in Fig. 9 . Increasing concentrations of HDL3 in the medium dose-dependently stimulated the cellular efflux of [3H]cholesterol. The rates of [3H]cholesterol flux were similar for macrophages isolated from WT and SR-BI KO mice (Fig. 9). In addition to HDL3, lipid-free apoA-I (20 µg protein/ml) time-dependently (1.0–6.0 h) stimulated the efflux of [3H]cholesterol in WT and SR-BI KO macrophages (data not shown). Again, no difference in [3H]cholesterol efflux between WT and SR-BI KO macrophages was detected when apoA-I was the lipid acceptor.


Figure 9
View larger version (6K):
[in this window]
[in a new window]
  		Fig. 9. [3H]cholesterol efflux from WT and SR-BI KO macrophages, and dose-response curves for human HDL3. The cell cholesterol of macrophages from WT (A) and SR-BI KO (B) mice was labeled with [3H]cholesterol. Then, macrophages were incubated (37°C, 5.0 h) in medium containing human HDL3; the respective HDL3 concentrations are given on the abscissae. [3H]cholesterol efflux was analyzed as described in Materials and Methods. Values are means ± SEM of three incubations. Where no error bars are shown, the SEMs were smaller than the respective symbols. a P = 0.10, b P = 0.005, c P = 0.53, d P = 0.01, e P = 0.38. Two independent similar experiments yielded qualitatively identical results.

 
Macrophage cholesterol mass flux
Concerning the interaction between macrophages and HDL, this study shows that macrophages internalize esterified cholesterol from HDL selectively. In parallel, HDL promotes the efflux of unesterified cellular cholesterol. These observations are based on experiments using radioisotopes; therefore, no conclusion concerning the net mass cholesterol flux between macrophages and HDL can be made. To address net mass cholesterol flux between HDL and cells under the experimental conditions of this study, WT and SR-BI KO macrophages were incubated (37°C) in medium containing unlabeled WT-HDL or SR-BI KO-HDL (Table 2 ). After 2 or 300 min of incubation, cells were harvested and cell cholesterol mass was analyzed. Between 2 and 300 min of incubation, a decrease in macrophage cholesterol mass was observed under all conditions. However, SR-BI KO-HDL more efficiently promoted a decline in cell cholesterol compared with WT-HDL in both WT and SR-BI KO macrophages (Table 2).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Macrophage cholesterol mass after incubation with HDL

 
CD36 and macrophage HDL metabolism
The class B scavenger receptor CD36 is expressed in macrophages (33). This receptor protein binds HDL with high affinity but mediates selective HDL CE, presumably at a low rate compared with SR-BI (34, 35). To explore a possible role of CD36 in selective CE uptake and in cholesterol efflux, the expression of this protein in macrophages isolated from WT mice or from SR-BI KO animals was investigated on immunoblots (Fig. 10 ) (30). CD36 expression was detected in WT and SR-BI KO macrophages, and the respective signal was identical in both cell types.


Figure 10
View larger version (17K):
[in this window]
[in a new window]
  		Fig. 10. Immunoblot analysis for CD36 in WT or SR-BI KO macrophages. Macrophages were isolated from WT or SR-BI KO mice, and postnuclear supernatants were prepared. Then, proteins were fractionated by SDS-PAGE (10%). After transfer to nitrocellulose, the proteins were immunoblotted with an anti-mouse CD36 antiserum or with a ß-actin antibody, as described in Materials and Methods. Two similar blots yielded qualitatively identical results.

 
The function of CD36 in selective HDL CE uptake by macrophages was addressed directly. Macrophages were isolated from WT mice and from CD36 KO (homozygous) animals (20). WT or CD36-deficient cells were incubated in medium containing 125I-TC-/[3H]CEt-HDL3 (Fig. 11 ). Increasing concentrations of radiolabeled HDL3 yielded a dose-dependent increase in cellular uptake of 125I-TC and [3H]CEt; as result, apparent selective HDL3 CE uptake ([3H]CEt – 125I-TC) increased in an HDL3 concentration-dependent manner. The rate of selective HDL3 CE uptake was very similar in macrophages isolated from WT and CD36 KO mice (Fig. 11).


Figure 11
View larger version (8K):
[in this window]
[in a new window]
  		Fig. 11. Uptake of human 125I-TC-/[3H]CEt-HDL3 by WT or CD36 KO macrophages. Macrophages from WT (A) and CD36 KO (B) mice were incubated (37°C, 4.0 h) in medium containing human 125I-TC-/[3H]CEt-HDL3; the respective HDL3 concentrations are given on the abscissae. Then, cellular tracer content and apparent HDL3 particle uptake were analyzed. 125I represents apparent HDL3 particle uptake according to 125I-TC-labeled protein; [3H] demonstrates apparent particle uptake attributable to [3H]CEt; and [3H]–125I shows the difference (i.e., apparent selective CE uptake). Values are means ± SEM of three independent incubations. Where no error bars are shown, the SEMs were smaller than the respective symbols. For selective uptake, * P = 0.083, ** P = 0.43, *** P = 0.013, **** P = 0.85.

 
HDL binding to macrophages
HDL binding to the cell surface is established (28). WT-HDL and SR-BI KO-HDL had different effects on HDL uptake and on cholesterol efflux from macrophages. To address the issue of whether these differences are related to variations in HDL binding to the cell membrane, binding of 125I-TC-HDL to macrophages was explored (Fig. 12 ). WT and SR-BI KO macrophages were incubated (4°C) in medium containing 125I-TC-WT-HDL or 125I-TC-SR-BI KO-HDL. 125I-TC-WT-HDL and 125I-TC-SR-BI KO-HDL bound in a dose-dependent manner to both types of macrophages. Binding of 125I-TC-SR-BI KO-HDL quantitatively was higher compared with 125I-TC-WT-HDL. No difference in 125I-TC-HDL binding to macrophages with or without SR-BI expression was observed (Fig. 12).


Figure 12
View larger version (7K):
[in this window]
[in a new window]
  		Fig. 12. Binding of 125I-TC-WT-HDL and 125I-TC-SR-BI KO-HDL to WT or SR-BI KO macrophages. Macrophages from WT (A) and SR-BI KO (B) mice were incubated (4°C, 2.0 h) in DMEM containing 125I-TC-WT-HDL or 125I-TC-SR-BI KO-HDL; the respective HDL concentrations are given on the abscissae. Then, cellular tracer association was analyzed. Values are means ± SEM of three independent incubations. Where no error bars are shown, the SEMs were smaller than the respective symbols. One independent experiment yielded qualitatively identical results.

 
To explore the binding of human 125I-TC-HDL3 to murine cells, macrophages isolated from WT or SR-BI KO mice were incubated (4°C, 2.0 h) in medium containing human 125I-TC-HDL3 (10, 20, 40, 100, and 200 µg HDL3/ml) (data not shown). Binding of this tracer preparation to both types of cells was very similar. Thus, murine HDL and human HDL3 yielded qualitatively identical results with respect to binding to cells.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Murine peritoneal macrophages selectively took up HDL-associated CE in this investigation. This result is consistent with previous observations in this cell type (11, 12, 25). Macrophages express SR-BI, and this was confirmed here in terms of mRNA and protein (11, 13, 15, 32, 36). Macrophages with and without SR-BI expression selectively took up HDL CE in this study, and the respective rates for this lipid internalization were similar in the absence or presence of this HDL receptor. HDL selective CE uptake was regulated as a function of cell cholesterol in macrophages with and without SR-BI expression. These observations provide evidence that macrophages have a mechanism for selective CE uptake that is distinct from SR-BI.

These results regarding an SR-BI-independent mechanism for HDL selective CE uptake are consistent with previous conclusions. Lipoprotein lipase and hepatic lipase stimulated selective CE uptake in vitro to a similar extent independent of cellular SR-BI expression levels (26). More relevant, in vivo selective HDL CE uptake by adrenals was observed in mutant SR-BI KO mice (7). In summary, the results presented here as well as other in vitro and in vivo experiments provide evidence for a cellular mechanism for HDL selective CE uptake distinct from SR-BI.

HDL from WT mice is different from the respective preparation isolated from SR-BI KO animals (6, 7, 17–19). SR-BI KO-HDL, which contains large HDL particles, is enriched in free cholesterol and apoE, and this was confirmed here for this lipoprotein fraction whether it was radiolabeled or not. Because of these differences, both HDL preparations were used as ligands for the selective CE uptake pathway. SR-BI KO-HDL donated CE to cells at lower rates compared with WT-HDL. This result was true irrespective of the SR-BI expression level or the cell model. In cells without (i.e., SR-BI KO macrophages) and in cells with (i.e., transfected BHK cells) high SR-BI expression, SR-BI KO-HDL yielded a low rate of selective uptake. In contrast, WT-HDL donated CE at substantially higher rates to the respective model. Prominent differences between SR-BI KO-HDL and WT-HDL were an enrichment of the former fraction in unesterified cholesterol and apoE and the larger average size of SR-BI KO-HDL (6, 7, 17–19). These differences in physical properties and composition apparently have a profound effect on the rates of selective CE uptake by a given cell. This variation in the rate of selective CE uptake between WT-HDL and SR-BI KO-HDL was true whether selective CE uptake was mediated by SR-BI or by an SR-BI-independent mechanism. Therefore, these differences in selective CE uptake must be explained by features of the ligand particle and not by the cellular mechanism that mediates its internalization.

Which mechanism facilitates the SR-BI-independent selective HDL CE uptake at the molecular level? Besides SR-BI, another member of the class B scavenger receptor family (i.e., the multiligand receptor CD36) is expressed in macrophages (33). CD36 binds HDL but presumably mediates HDL selective CE uptake at a low rate compared with SR-BI (34, 35). In this study, CD36 expression was identical in macrophages isolated from WT and SR-BI KO mice. Additionally, selective CE uptake from HDL was identical in macrophages prepared from WT and CD-deficient mice (CD36 KO). These observations argue against a role of CD36 in the SR-BI-independent selective HDL CE uptake. A novel efflux-recapture mechanism may mediate selective HDL CE uptake in adipocytes (37). Accordingly, CEs that are associated with the plasma membrane are captured by apoE. ApoE-associated CEs are finally internalized by cells in a mechanism that involves the low density lipoprotein receptor-related protein. Assuming that both macrophages and adipocytes express this pathway, then it is possible that this mechanism has a function in selective HDL CE uptake in SR-BI-deficient cells. Lipid-lipid interactions between the phospholipid monolayer of the lipoprotein surface and the cellular plasma membrane may play a role in the selective transfer of lipids to cells (38). The results of this study are compatible with this model. However, the SR-BI-independent HDL selective CE uptake observed here in macrophages may be mediated by several mechanisms simultaneously. Additional receptor proteins that facilitate selective lipid uptake may be defined in the future.

Removal of unesterified [3H]cholesterol from macrophages was similar in this study in the absence or presence of SR-BI. This was true whether HDL or apoA-I was the cholesterol acceptor. This observation is consistent with recent studies (15, 39). Therefore, in macrophages, a mechanism distinct from SR-BI mediates cholesterol efflux. Quantitatively, the contribution of these pathways is substantial (39). Besides SR-BI, several alternative mechanisms for cellular cholesterol removal have been defined (2). One pathway is the efflux of unesterified cholesterol via aqueous diffusion, although quantitatively this route is inefficient (2). ABCA1 mediates both cholesterol and phospholipid efflux; however, lipid-poor apoA-I, and not HDL, appears to be the preferred cholesterol acceptor for this protein (40). Therefore, a direct role of ABCA1 in the HDL-mediated and SR-BI-independent cholesterol efflux from macrophages is unlikely. ABCG1 and ABCG4 are members of the ABC transporter family as well, and these molecules may mediate cholesterol efflux from macrophages (41). These transporters stimulate cholesterol efflux preferentially to HDL as acceptor, so it seems possible that these molecules may play a role in cholesterol efflux in SR-BI-deficient macrophages. Additionally, it cannot be excluded that several pathways distinct from SR-BI mediate cholesterol efflux from macrophages simultaneously. In summary, the data presented here suggest that SR-BI-independent mechanisms play a major role for cholesterol efflux in macrophages.

Acceptors for excess cell cholesterol are apoA-I, the dominant protein component of HDL, and HDL itself (2). In this study, murine WT-HDL, murine SR-BI KO-HDL, human HDL3, and human apoA-I accelerated cholesterol removal from murine macrophages. However, SR-BI KO-HDL more efficiently promoted cholesterol efflux compared with WT-HDL. Thus, analogous to HDL uptake, quantitatively the effects of both murine HDL preparations on cholesterol efflux differ significantly. These observations imply that the physical properties (i.e., size) and/or composition of a given HDL particle determine its ability to accept excess cellular cholesterol. Relevant in this context are recent results obtained with HDL2 originating from cholesteryl ester transfer protein (CETP)-deficient patients (42). These particles are larger and are enriched in cholesterol compared with HDL2 from controls. HDL2 from CETP-deficient patients stimulates cholesterol efflux from macrophages at a higher rate than control HDL2. Both these data (42) and the results of this study point to the role of HDL particle size and composition in the ability of a given lipoprotein to facilitate cholesterol efflux from macrophages.

Initially, the interaction between macrophages and HDL (i.e., HDL selective CE uptake and cholesterol efflux) was analyzed with radioisotopes. However, these results do not yield conclusions with respect to the net effect of this interaction on cell cholesterol mass. The question was raised whether net cholesterol uptake or net cholesterol efflux from macrophages occurs under these conditions. Here, an incubation of macrophages in medium containing HDL yielded a net decrease in cell cholesterol mass. This reduction was more pronounced using SR-BI KO-HDL, and this result is consistent with [3H]cholesterol efflux from macrophages.

To define in more detail a potential mechanism by which SR-BI KO-HDL more efficiently stimulates cholesterol removal from macrophages and induces a greater decrease in cell cholesterol mass compared with WT-HDL, binding (4°C) of 125I-TC-HDL was explored. Binding of 125I-TC-SR-BI KO-HDL to macrophages was higher compared with that of 125I-TC-WT-HDL, and this was true for both WT and SR-BI KO macrophages. Quantitatively, 125I-TC-WT-HDL and 125I-TC-SR-BI KO-HDL binding to WT and SR-BI KO macrophages was similar. The increased binding of 125I-TC-SR-BI KO-HDL to both types of macrophages is one potential explanation for why this lipoprotein fraction more efficiently promotes cellular cholesterol efflux.

In bone marrow transplantation experiments with mice, macrophage SR-BI expression protected against atherosclerosis (14–16). In contrast, in the vessel wall of SR-BI-deficient mice, atherogenesis was accelerated (17). Therefore, macrophage SR-BI expression has an essential role in atherosclerosis. This study is compatible with the hypothesis that the atheroprotective effect of SR-BI is not mediated by a direct role of this protein in HDL cholesterol metabolism of macrophages. SR-BI-independent mechanisms may compensate for the function of this receptor, at least in murine macrophages. However, SR-BI is a multiligand receptor for HDL, LDL, oxidized LDL, acetylated LDL, and small unilamellar vesicles (43). An SR-BI-mediated uptake of these molecules by macrophages could have a role in atherogenesis and may explain the protective effect of this receptor on atherosclerosis in rodents.


   ACKNOWLEDGMENTS
 
This investigation was supported by Research Grant Ri 436/8-1 from the Deutsche Forschungsgemeinschaft (Bonn, Germany). The assistance of Mrs. S. Ehret, Mrs. B. Keller, Mrs. B. Schulz, and Mrs. M. Thiel in these studies is gratefully acknowledged. CETP was a kind gift from Dr. Richard E. Morton and Mrs. Diane Greene.

Submitted on March 21, 2006
Revised on August 2, 2006


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
  1. Tall, A. R. 1990. Plasma high density lipoproteins. Metabolism and relationship to atherogenesis. J. Clin. Invest. 86: 379–384.[Medline]

  2. Yancey, P. G., A. E. Bortnick, G. Kellner-Weibel, M. de la Llera-Moya, M. C. Phillips, and G. H. Rothblat. 2003. Importance of different pathways of cellular cholesterol efflux. Arterioscler. Thromb. Vasc. Biol. 24: 712–719.

  3. Morton, R. E., and D. B. Zilversmit. 1982. Purification and characterization of lipid transfer protein(s) from human lipoprotein-deficient plasma. J. Lipid Res. 23: 1058–1067.[Abstract]

  4. Glass, C., R. C. Pittman, M. Civen, and D. Steinberg. 1985. Uptake of high-density lipoprotein-associated apoprotein A-I and cholesterol esters by 16 tissues of the rat in vivo and by adrenal cells and hepatocytes in vitro. J. Biol. Chem. 260: 744–750.[Abstract/Free Full Text]

  5. Acton, S., A. Rigotti, K. T. Landschulz, S. Xu, H. H. Hobbs, and M. Krieger. 1996. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science. 271: 518–520.[Abstract]

  6. Rigotti, A., B. L. Trigatti, M. Penman, H. Rayburn, J. Herz, and M. Krieger. 1997. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc. Natl. Acad. Sci. USA. 94: 12610–12615.[Abstract/Free Full Text]

  7. Brundert, M., A. Ewert, J. Heeren, B. Behrendt, R. Ramakrishnan, H. Greten, M. Merkel, and F. Rinninger. 2005. Scavenger receptor class B type I mediates the selective uptake of high-density lipoprotein-associated cholesteryl ester by the liver in mice. Arterioscler. Thromb. Vasc. Biol. 25: 143–148.[Abstract/Free Full Text]

  8. Out, R., M. Hoekstra, J. A. A. Spijkers, J. K. Kruijt, M. van Eck, I. S. T. Bos, J. Twisk, and T. J. C. van Berkel. 2004. Scavenger receptor class B type I is solely responsible for the selective uptake of cholesteryl esters from HDL by the liver and the adrenals in mice. J. Lipid Res. 45: 2088–2095.[Abstract/Free Full Text]

  9. Ji, Y., B. Jian, N. Wang, Y. Sun, M. de la Llera Moya, M. C. Phillips, G. H. Rothblat, J. B. Swaney, and A. R. Tall. 1997. Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux. J. Biol. Chem. 272: 20982–20985.[Abstract/Free Full Text]

  10. Ross, R. 1999. Atherosclerosis—an inflammatory disease. N. Engl. J. Med. 340: 115–126.[Free Full Text]

  11. Matveev, S., D. R. van der Westhuyzen, and E. J. Smart. 1999. Co-expression of scavenger receptor-BI and caveolin-1 is associated with enhanced selective cholesteryl ester uptake in THP-1 macrophages. J. Lipid Res. 40: 1647–1654.[Abstract/Free Full Text]

  12. Rinninger, F., J. T. Deichen, S. Jäckle, E. Windler, and H. Greten. 1994. Selective uptake of high-density lipoprotein-associated cholesteryl esters and high-density lipoprotein particle uptake by human monocyte-macrophages. Atherosclerosis. 105: 145–157.[CrossRef][Medline]

  13. Chinetti, G., F. G. Gbaguidi, S. Griglio, Z. Mallat, M. Antonucci, P. Poulain, J. Chapman, J. C. Fruchart, A. Tedgui, J. Najib-Fruchart, et al. 2000. CLA-1/SR-BI is expressed in atherosclerotic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors. Circulation. 101: 2411–2417.[Abstract/Free Full Text]

  14. Van Eck, M., I. S. T. Bos, R. B. Hildebrand, B. T. van Rij, and T. J. C. van Berkel. 2004. Dual role of scavenger receptor class B type I on bone marrow-derived cells in atherosclerotic lesion development. Am. J. Pathol. 165: 785–794.[Abstract/Free Full Text]

  15. Zhang, W., P. G. Yancey, Y. R. Su, V. R. Babaev, Y. Zhang, S. Fazio, and M. R. F. Linton. 2003. Inactivation of macrophage scavenger receptor class B type I promotes atherosclerotic lesion development in apolipoprotein E-deficient mice. Circulation. 108: 2258–2263.[Abstract/Free Full Text]

  16. Covey, S. D., M. Krieger, W. Wang, M. Penman, and B. L. Trigatti. 2003. Scavenger receptor class B type I-mediated protection against atherosclerosis in LDL receptor-negative mice involves its expression in bone marrow-derived cells. Arterioscler. Thromb. Vasc. Biol. 23: 1589–1594.[Abstract/Free Full Text]

  17. Van Eck, M., J. Twisk, M. Hoekstra, B. T. van Rij, C. A. C. van der Lans, I. S. T. Bos, J. K. Kruijt, F. Kuipers, and T. J. C. van Berkel. 2003. Differential effects of scavenger receptor BI deficiency on lipid metabolism in cells of the arterial wall and in the liver. J. Biol. Chem. 278: 23699–23705.[Abstract/Free Full Text]

  18. Ma, K., T. Forte, J. D. Otvos, and L. Chan. 2005. Differential additive effects of endothelial lipase and scavenger receptor-class B type I on high-density lipoprotein metabolism in knockout mouse models. Arterioscler. Thromb. Vasc. Biol. 25: 149–154.[Abstract/Free Full Text]

  19. Braun, A., S. Zhang, H. E. Miettinen, S. Ebrahim, T. M. Holm, E. Vasile, M. J. Post, D. M. Yoerger, M. H. Picard, J. L. Krieger, et al. 2003. Probucol prevents early coronary heart disease and death in the high-density lipoprotein receptor SR-BI/apolipoprotein E double knockout mouse. Proc. Natl. Acad. Sci. USA. 100: 7283–7288.[Abstract/Free Full Text]

  20. Moore, K. J., J. El Khoury, L. A. Medeiros, K. Tereda, C. Geula, A. D. Luster, and M. W. Freeman. 2002. A CD36-initiated signalling cascade mediates inflammatory effects of beta-amyloid. J. Biol. Chem. 277: 47373–47379.[Abstract/Free Full Text]

  21. Rinninger, F., M. Brundert, S. Jäckle, P. R. Galle, C. Busch, J. R. Izbicki, X. Rogiers, D. Henne-Bruns, B. Kremer, C. E. Broelsch, et al. 1994. Selective uptake of high-density lipoprotein-associated cholesteryl esters by human hepatocytes in primary culture. Hepatology. 19: 1100–1114.[CrossRef][Medline]

  22. Basu, S. K., J. L. Goldstein, R. G. W. Anderson, and M. S. Brown. 1976. Degradation of cationized low density lipoprotein and regulation of cholesterol metabolism in homozygous familial hypercholesterolemia fibroblasts. Proc. Natl. Acad. Sci. USA. 73: 3178–3182.[Abstract/Free Full Text]

  23. Pittman, R. C., and C. A. Taylor, Jr. 1986. Methods for assessment of tissue sites of lipoprotein degradation. Methods Enzymol. 129: 612–628.[Medline]

  24. Chen, W., D. L. Silver, J. D. Smith, and A. R. Tall. 2000. Scavenger receptor-BI inhibits ATP-binding cassette transporter 1-mediated cholesterol efflux in macrophages. J. Biol. Chem. 275: 30794–30800.[Abstract/Free Full Text]

  25. Panzenboeck, U., A. Wintersberger, S. Levak-Frank, R. Zimmermann, R. Zechner, G. M. Kostner, E. Malle, and W. Sattler. 1997. Implications of endogenous and exogenous lipoprotein lipase for the selective uptake of HDL3-associated cholesteryl esters by mouse peritoneal macrophages. J. Lipid Res. 38: 239–253.[Abstract]

  26. Rinninger, F., M. Brundert, I. Brosch, N. Donarski, R. M. Budzinski, and H. Greten. 2001. Lipoprotein lipase mediates an increase in selective uptake of HDL-associated cholesteryl esters by cells in culture independent of scavenger receptor BI. J. Lipid Res. 42: 1740–1751.[Abstract/Free Full Text]

  27. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1957. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193: 265–275.

  28. Oram, J. F., E. A. Brinton, and E. L. Bierman. 1983. Regulation of high density lipoprotein receptor activity in cultured human skin fibroblasts and human arterial smooth muscle cells. J. Clin. Invest. 72: 1611–1621.[Medline]

  29. Webb, N. R., P. M. Connell, G. A. Graf, E. J. Smart, W. J. S. de Villiers, F. C. de Beer, and D. van der Westhuyzen. 1998. SR-BII, an isoform of the scavenger receptor BI containing an alternate cytoplasmic tail, mediates lipid transfer between high density lipoprotein and cells. J. Biol. Chem. 273: 15241–15248.[Abstract/Free Full Text]

  30. Moore, K. J., E. D. Rosen, M. L. Fitzgerald, F. Randow, L. P. Andersson, D. Altshuler, D. S. Milstone, R. M. Mortensen, B. M. Spiegelman, and M. W. Freeman. 2001. The role of PPAR-gamma in macrophage differentiation and cholesterol uptake. Nat. Med. 7: 41–47.[CrossRef][Medline]

  31. Nichols, A. V., R. M. Krauss, and T. A. Musliner. 1986. Nondenaturing polyacrylamide gradient gel electrophoresis. Methods Enzymol. 128: 417–431.[Medline]

  32. Yu, L., G. Cao, J. Repa, and H. Stangl. 2004. Sterol regulation of scavenger receptor class B type I in macrophages. J. Lipid Res. 45: 889–899.[Abstract/Free Full Text]

  33. Febbraio, M., D. P. Hajjar, and R. L. Silverstein. 2001. CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J. Clin. Invest. 108: 785–791.[CrossRef][Medline]

  34. Gu, X., B. Trigatti, S. Xu, S. Acton, K. Babitt, and M. Krieger. 1998. The efficient cellular uptake of high density lipoprotein lipids via scavenger receptor class B type I requires not only receptor-mediated surface binding but also receptor-specific lipid transfer mediated by its extracellular domain. J. Biol. Chem. 273: 26338–26348.[Abstract/Free Full Text]

  35. Connelly, M. A., S. M. Klein, S. Azhar, N. A. Abumrad, and D. L. Williams. 1999. Comparison of class B scavenger receptors, CD36 and scavenger receptor BI (SR-BI), shows that both receptors mediate high density lipoprotein-cholesteryl ester selective uptake but SR-BI exhibits a unique enhancement of cholesteryl ester uptake. J. Biol. Chem. 274: 41–47.[Abstract/Free Full Text]

  36. Hirano, H. S., S. Yamashita, Y. Nakagawa, T. Ohya, F. Matsuura, K. Tsukamoto, Y. Okamoto, A. Matsuyama, K. Matsumoto, J. Miyagawa, et al. 1999. Expression of human scavenger receptor class B type I in cultured human monocyte-derived macrophages and atherosclerotic lesions. Circ. Res. 85: 108–116.[Abstract/Free Full Text]

  37. Vassiliou, G., and R. McPherson. 2004. A novel efflux-recapture process underlies the mechanism of high-density lipoprotein cholesteryl ester-selective uptake mediated by the low-density lipoprotein receptor-related protein. Arterioscler. Thromb. Vasc. Biol. 24: 1669–1675.[Abstract/Free Full Text]

  38. Morrison, J. R., M. J. Silvestre, and R. C. Pittman. 1994. Cholesteryl ester transfer between high density lipoprotein and phospholipid bilayers. J. Biol. Chem. 269: 13911–13918.[Abstract/Free Full Text]

  39. Duong, M., H. L. Collins, W. Jin, I. Zanotti, E. Favari, and G. H. Rothblat. 2006. Relative contributions of ABCA1 and SR-BI to cholesterol efflux to serum from fibroblasts and macrophages. Arterioscler. Thromb. Vasc. Biol. 26: 541–547.[Abstract/Free Full Text]

  40. Oram, J. F., R. M. Lawn, M. R. Garvin, and D. P. Wade. 2000. ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages. J. Biol. Chem. 275: 34508–34511.[Abstract/Free Full Text]

  41. Wang, N., D. Lan, W. Chen, F. Matsuura, and A. R. Tall. 2004. ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc. Natl. Acad. Sci. USA. 101: 9774–9779.[Abstract/Free Full Text]

  42. Matsuura, F., N. Wang, W. Chen, X-C. Jiang, and A. R. Tall. 2006. HDL from CETP-deficient subjects shows enhanced ability to promote cholesterol efflux from macrophages in an apo E-and ABCG1-dependent pathway. J. Clin. Invest. 116: 1435–1442.[CrossRef][Medline]

  43. Rigotti, A., S. L. Acton, and M. Krieger. 1995. The class B scavenger receptors SR-BI and CD36 are receptors for anionic phospholipids. J. Biol. Chem. 270: 16221–16224.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
L. Yvan-Charvet, T. A. Pagler, N. Wang, T. Senokuchi, M. Brundert, H. Li, F. Rinninger, and A. R. Tall
SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL
J. Lipid Res., January 1, 2008; 49(1): 107 - 114.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M600136-JLR200v1
47/11/2408    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brundert, M.
Right arrow Articles by Rinninger, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brundert, M.
Right arrow Articles by Rinninger, F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Molecular and Cellular Proteomics   ASBMB Today 
Advertisement
spacer
Advertisement
Advertisement