|
Originally published In Press as doi:10.1194/jlr.C600019-JLR200 on November 28, 2006
Journal of Lipid Research, Vol. 48, 503-508, March 2007
Copyright © 2007 by American Society for Biochemistry and Molecular Biology
Identification and characterization of human ethanolaminephosphotransferase1
Yasuhiro Horibata and
Yoshio Hirabayashi1
Neuronal Circuit Mechanisms Research Group, Brain Science Institute, RIKEN, Hirosawa 2-1, Wako-shi, Saitama 351-0198, Japan
Published, JLR Papers in Press, November 28, 2006.
1 To whom correspondence should be addressed. e-mail: hirabaya{at}riken.jp
ABSTRACT
CDP-ethanolamine:diacylglycerol ethanolaminephosphotransferase (EPT) catalyzes the transfer of phosphoethanolamine from CDP-ethanolamine to diacylglycerol to produce phosphatidylethanolamine (PE). To date, the dual specificity of choline/ethanolaminephosphotransferase (CEPT) has been recognized as the total activity responsible for the synthesis of PE via the CDP-ethanolamine pathway in human. We report here the identification and characterization of another human cDNA that encodes CDP-ethanolamine-specific human EPT (hEPT1). Through homology search, we found that human selenoprotein I contained the CDP-alcohol phosphatidyltransferase signature, a common motif conserved in phospholipid synthases. Bacterial expression of the cDNA in Escherichia coli demonstrated that the product specifically used CDP-ethanolamine as the phosphobase donor to produce PE with the activation by both Mn2+ and Mg2+. RT-PCR and Northern blot analysis revealed that hEPT1 was ubiquitously expressed in multiple tissues, but in brain it was highly expressed in cerebellum. Here, we propose that in addition to previously identified CEPT, hEPT1 is involved in the biosynthesis of PE via the Kennedy pathway.
Supplementary key words phosphatidylethanolamine selenoprotein I phospholipid Abbreviations: CEPT, choline/ethanolaminephosphotransferase; CPT, cholinephosphotransferase; EPT, ethanolaminephosphotransferase; EST, expressed sequence tag; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PS, phosphatidylserine
Phosphatidylethanolamine (PE) in an abundant phospholipid in mammals, generally constituting 25% of cellular phospholipids (1). In various eukaryotic plasma membranes, aminophospholipids such as PE and phosphatidylserine (PS) reside in the inner leaflet, whereas choline-containing phospholipids such as phosphatidylcholine (PC) and sphingomyelin are localized mainly in the outer leaflet (1). Important roles for PE are as precursors of the glycosylphosphatidylinositol anchors, which are covalently attached to many cell surface proteins, and of N-acylethanolamine, which works as a neurotransmitter in the brain. Recent studies also revealed that PE is involved in membrane fusion events (2), the regulation of lipid metabolism in Drosophila (3), and protein folding (4).
In mammals, the biosynthesis of PE occurs by two major routes. One is the mitochondrial decarboxylation of PS (5). The other is the CDP-ethanolamine pathway, as originally described by Kennedy and Weiss (6) in 1956. In this process, the phosphoethanolamine from CDP-ethanolamine is transferred to diacylglycerol with the release of CMP and the production of PE by ethanolaminephosphotransferase (EPT). This enzyme is an integral membrane protein found primarily on endoplasmic reticulum membranes (7). Mutants of Saccharomyces cerevisiae defective in EPT activity were generated that permitted the identification of the EPT1 gene, which encodes for EPT. The EPT1 gene product, however, has dual specificity capable of using both CDP-ethanolamine and CDP-choline to produce PE and PC, respectively; that is, the enzyme possess cholinephosphotransferase (CPT) activity half as active as EPT activity (8). Based on sequence homology to the yeast sequence, a human cDNA that codes for a choline/ethanolaminephosphotransferase (CEPT) was identified (9). This enzyme (hCEPT1) also catalyzes both PC and PE production, possessing CPT activity >2-fold higher than EPT activity. After the discovery of hCEPT1, it was thought that in mammalian cells, the dual specificity of CEPT was totally responsible for the synthesis of PE via the CDP-ethanolamine pathway.
In this study, we found that a human expressed sequence tag (EST) clone annotated as selenoprotein I possesses the CDP-alcohol phosphatidyltransferase motif, a common motif conserved in phospholipid synthases. Expression of selenoprotein I in Escherichia coli showed CDP-ethanolamine-specific phosphatidyltransferase activity, indicating that the cDNA encodes a human EPT, now termed hEPT1. Here, we propose that in addition to previously identified hCEPT1, hEPT1 is involved in the biosynthesis of PE via the Kennedy pathway.
MATERIALS AND METHODS
Materials
Precoated Silica Gel 60 TLC plates were purchased from Merck. [ -32P]dCTP was from MP Biomedicals. [ethanolamine-1,2-14C]CDP-ethanolamine (50 mCi/mmol) and [methyl-14C]CDP-choline (55 mCi/mmol) were from American Radiolabeled Chemicals. Diacylglycerol was from Doosan Biotech Co. All other reagents were of the highest purity available.
Identification and cloning of hEPT1
A Basic Local Alignment Search Tool search was performed against the EST database with reference to the CDP-alcohol phosphatidyltransferase motif DG(X)2AR(X)8G(X)3D(X)3D. An EST clone (KIAA1724) (10) containing selenoprotein I cDNA was obtained from the Kazusa DNA Research Institute and sequenced. The full-length cDNA was amplified by PCR using Pyrobest DNA polymerase (Takara Bio) and subcloned into EcoRI/XhoI sites of the E. coli expression vector, pET23a (Novagen).
RT-PCR and Northern blot analysis
For RT-PCR, first-strand cDNA from multiple human tissues (Human MTC Panel I; Clontech) was amplified by PCR using the upper (TGAGGCCTGGTATGAACCTTTCCTGT) and lower (AGAGGCTACTCCTAGGTTTACCACT) primers to obtain a 406 bp fragment, according to the instructions of the manufacturer.
Premade Northern blots containing poly(A) RNA from eight different human brain tissues (Human Brain MTN Blot II; Clontech) were hybridized with random-primed 32P-labeled probes (the entire 1.2 kb coding region of hEPT1) at 68°C for 1 h and washed according to the manufacturer's instructions. Membranes were analyzed with the BAS-3000 imaging analyzer (Fujifilm, Tokyo, Japan).
Expression and preparation of hEPT1 in E. coli
E. coli strain BL21(DE3)pLysS cells (Novagen) transformed with the expression vector was grown at 25°C in Luria-Bertani medium supplemented with 100 µg/ml ampicillin and 35 µg/ml chloramphenicol with shaking. Protein expression was induced by adding isopropyl ß-D-thiogalactoside at a final concentration of 0.1 mM. After cultivation, cells were harvested and suspended in extraction solution (50 mM Tri-HCl buffer, pH 8.0, containing 5 µg/ml leupeptin and 1 mM PMSF). The cell suspension was frozen at 20°C and then sonicated. After removal of cell debris by centrifugation (15,000 g for 10 min), the supernatant was ultracentrifuged at 100,000 g for 60 min. The membrane precipitated was suspended in the extraction solution and used as an enzyme source.
Enzyme assays
Enzyme activity was determined using the membrane fraction of E. coli transformed with hEPT1. The reaction mixture contained 50 mM Tris-HCl buffer, pH 8.0, 5 mM MnCl2, 1 mM EGTA, 0.5 mM diacylglycerol, 0.002% (w/v) Tween 20, 5 µg of membrane fraction, and 20 µM CDP-ethanolamine (50 mCi/mmol) or CDP-choline (55 mCi/mmol). After incubation at 37°C for 10 min, the reaction was stopped by adding 600 µl of chloroform-methanol (1:1, v/v) followed by 300 µl of 0.9% KCl. After centrifugation at 8,000 g for 5 min, the organic phase was dried and applied to TLC plates, which were then developed with chloroform-methanol-water (65:35:8, v/v/v). Radioactive phospholipids were analyzed with an imaging analyzer (BAS-3000) and quantified with Image Gauge version 3.0.
RESULTS
Identification of hEPT1
The CDP-alcohol phosphatidyltransferase motif, DG(X)2AR(X)8G(X)3D(X)3D, is an amino acid sequence conserved in enzymes catalyzing the displacement of CMP from a CDP-alcohol by a second alcohol with formation of a phosphodiester bond and concomitant breaking of a phosphoride anhydride bond. It has been revealed that enzymes catalyzing the biosynthesis of phospholipids, such as CPT, CEPT, phosphatidylinositol synthase, cardiolipin synthase, and phosphatidylglycerol phosphate synthase, contain the CDP-alcohol phosphatidyltransferase motif. Through homology searches of human EST databases with reference to the motif, we found that a human cDNA annotated as selenoprotein I (GenBank accession number NM_033505) completely conserved it, suggesting that this protein would function as CDP-alcohol phosphatidyltransferase (Fig. 1A
). The homolog genes were also found in the EST database of Mus musculus (NP_081928), Xenopus tropicalis (NP_001004832), Drosophila melanogaster (NP_788074), and Caenorhabditis elegans (NP_491454), showing 88, 78, 43, and 39% identities to human cDNA at the amino acid level. Therefore, we considered the human selenoprotein I as a putative hEPT1. Kryukov et al. (11) reported that the first stop codon of the cDNA (TGA at positions 1,1591,161) would function as a selenocysteine insertion codon using the computational program SECISearch (server at http://genome.unl.edu/SECISearch.html), annotated as selenoprotein I. Therefore, the open reading frame of the gene was composed of 1,194 nucleotides encoding 397 amino acids. From the deduced amino acid sequence, the molecular mass and isoelectric point of the hEPT1 were calculated to be 45,179 kDa and 6.13, respectively. A search for the transmembrane domain using a TMpred algorithm (http://www.ch.embnet.org/software/TMPRED_form.html) (12) suggested that the predicted amino acid sequence contains seven transmembrane helices (amino acid positions 5371, 85103, 150167, 190209, 221240, 261278, and 323342) (Fig. 1B). The hEPT1 sequence was mapped to a region of human chromosome 2.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1. Nucleotide and deduced amino acid sequences (A) and hydropathy plot (B) of the human ethanolaminephosphotransferase (hEPT1). A: The deduced amino acid sequence is shown in one-letter code below the nucleotide sequence. Amino acid residues are numbered beginning with the first methionine, and the translation termination codon is denoted with an asterisk. The putative selenocysteine (U) insertion codon is boxed. B: The deduced amino acid sequence of the hEPT1 was analyzed by the method of Kyte and Doolittle for hydropathy plotting. The seven candidate transmembrane domains are indicated as I to VII.
|
|
Figure 2
shows the alignment of predicted amino acid sequences of hEPT1, yeast EPT1 (yEPT1; NP_011991), and hCEPT1 (NP_006081). The open reading frame of hEPT1 showed 28% and 27% identity to that of yEPT1 and hCEPT1, respectively, at the amino acid level. The CDP-alcohol phosphatidyltransferase motif was all conserved in these enzymes.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2. Alignment of hEPT1 with yeast EPT1 and human choline/ethanolaminephosphotransferase (CEPT1). The predicted amino acid sequences of hEPT1, mouse EPT1 (mEPT1; NP_081928), Saccharomyces cerevisiae EPT1 (yEPT1; NP_011991), and human CEPT1 (hCEPT1; NP_006081) were aligned using the ClustalW algorithm. Identical amino acids are indicated by asterisks, and conserved and partially conserved amino acids are indicated by double dots and single dots, respectively. Gaps inserted into the sequences are indicated by dashed lines. Amino acid residues conserved in the CDP-alcohol phosphatidyltransferase motif are shown on a black background.
|
|
Expression and characterization of hEPT1
To clarify whether the putative hEPT1 has the ability to catalyze PE synthesis via the CDP-ethanolamine pathway, we expressed the cDNA in a bacterial expression system because prokaryotes including E. coli are devoid of the Kennedy pathway. As a result, ethanolamine phosphotransferase activity was observed in the membrane fraction of hEPT1-transformed cells, whereas no such activity was found in a vector control, indicating that selenoprotein I surely encodes EPT (Fig. 3A
). It was interesting that in contrast with yEPT1 and hCEPT1, hEPT1 showed no enzymatic activity catalyzing the production of PC by the use of CDP-choline. This result demonstrates that hEPT1 codes for a CDP-ethanolamine-specific phosphatidyltransferase.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3. Expression and characterization of hEPT1. A: Enzyme activities in the membrane fractions of mock-transfected (pET23a) and hEPT1-transfected E. coli were measured using CDP-ethanolamine or CDP-choline as the substrate in the presence of 5 mM Mn2+, as described in Materials and Methods. PC, phosphatidylcholine; PE, phosphatidylethanolamine. B: EPT activities in the membrane fraction of hEPT1-expressing cells were determined in the presence of various concentrations of Mn2+ or Mg2+. Data shown are means from a representative experiment. C: EPT and cholinephosphotransferase activities in the membrane fraction of hEPT1-expressing cells were measured using various concentrations of CDP-ethanolamine and CDP-choline in the presence of 5 mM Mn2+. Data shown are means from a representative experiment.
|
|
Next, we analyzed the effect of cations on the activity of hEPT1 (Fig. 3B). This enzyme required millimolar levels of each cation for activity. The maximum activation was observed at the concentration of 5 mM Mn2+, but it was inhibited at higher concentrations. In contrast, the optimum concentration of Mg2+ was 30 mM, and no significant inhibition was observed at higher concentrations up to 120 mM (data not shown).
Next, we investigated the kinetics of hEPT1 with CDP-ethanolamine and CDP-choline as the substrates in the presence of 5 mM Mn2+. Figure 3C shows the substrate saturation curve. When the concentration of CDP-choline in the reaction mixture was >25 µM, subtle PC was produced, yielding <3% PE. This result indicated that hEPT1 could, but very weakly, use CDP-choline as a substrate. Apparent Km and Vmax values of this enzyme for CDP-ethanolamine were estimated to be 1.8 µM and 76.3 pmol/min/mg.
Tissue expression pattern of hEPT1
To assess the tissue distribution of hEPT1, RT-PCR was conducted using a multiple human tissue cDNA. As shown in Fig. 4A
, the gene seemed to be expressed in all tissues. The expression of hEPT1 was abundant in brain, placenta, liver, and pancreas, followed by heart, skeletal muscle, lung, and kidney. Northern blots of various parts of human brain revealed that the hEPT1 gene was strongly expressed in cerebellum, followed by the occipital pole and the frontal lobe. The transcript size of hEPT1 was estimated to be 7.9 kb. This is approximately consistent with the size of mRNA for selenoprotein I (8,091 bp) as published in the GenBank database (NM_033505).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4. Expression pattern of hEPT1 in multiple human tissues. A: RT-PCR analysis of hEPT1. First-strand cDNA from various human tissues was amplified using hEPT1-specific primers. Glyceraldehyde 3-phosphate dehydrogenase (G3PDH) expression was also analyzed for an internal control. B: Poly(A) RNA from various brain parts was hybridized with radiolabeled probes prepared from the entire cDNA of hEPT1. The positions of molecular mass markers are indicated at left.
|
|
DISCUSSION
In mammalian cells, the biosynthesis of PE occurs by two different pathways. The first is the decarboxylation of PS in mitochondria by PS decarboxylase (5). The other is the CDP-ethanolamine pathway, as originally reported by Kennedy and Weiss (6). In this process, PE is synthesized by EPT, which catalyzes the transfer of ethanolamine from CDP-ethanolamine to diacylglycerol. To date, hCEPT1 has been thought to be the only enzyme involved in PE synthesis via the CDP-ethanolamine pathway in human. This enzyme, however, has dual specificity capable of using both CDP-ethanolamine and CDP-choline to produce PE and PC, respectively. In this study, we found that a cDNA annotated as selenoprotein I possesses EPT activity; this cDNA is termed hEPT1. Interestingly, in contrast to previously reported EPT enzymes such as hCEPT1 and yEPT1, hEPT1 specifically used CDP-ethanolamine as the phosphobase donor. This is the first report of the gene identification of CDP-ethanolamine-specific EPT.
Another CDP-ethanolamine-specific EPT, showing a Km value for CDP-ethanolamine 70 times smaller than that for CDP-choline, has also been purified to near homogeneity from bovine liver microsomes (13). A 38 kDa protein was demonstrated to show Mn2+-dependent EPT activity, whereas such activity was not detected in the presence of Mg2+. However, this is inconsistent with hEPT1, because this enzyme was activated by both cations. It may be possible that there is another CDP-ethanolamine-specific EPT in animals. Confirmation of the amino acid sequence of the purified protein will resolve this question. By contrast, the cation requirement of hEPT1 is similar to that of hCEPT1. The EPT activity of hCEPT1 was reported to be activated by both Mn2+ and Mg2+ and inhibited at higher Mn2+ concentrations.
Here, we fond that in brain, hEPT1 is strongly expressed in cerebellum. Interestingly, 3-phosphoglycerate dehydrogenase, a key enzyme for L-serine biosynthesis, is also abundantly expressed in cerebellum (14). Because L-serine is an essential precursor for the generation of ethanolamine (i.e., the biosynthesis of the compound in animals is only derived from the breakdown of PS or sphingolipids) (15), there may be abundant CDP-ethanolamine in cerebellum and the biosynthesis of PE by hEPT1 may also be more highly active.
Recently, knockout mice disrupted in PS decarboxylase were generated (16). The mice showed lethality between days 8 and 10 of embryonic development and abnormal morphology in mitochondria. Interestingly, however, the PE content of wild-type and knockout mice was almost the same. It was also revealed that PE synthesis via the CDP-ethanolamine pathway was increased in the knockout mice. These results suggest that the total content of cellular PE is regulated by both PS decarboxylation and CDP-ethanolamine phosphatidyltransfer, with a cross-talk mechanism to maintain phospholipid homeostasis. Study of whether or not PE synthesis via the CDP-ethanolamine pathway is also essential in mice is awaited, and our study will facilitate further research into the biological functions of PE.
ACKNOWLEDGMENTS
This work was supported by a fellowship from the Special Postdoctoral Researchers Program, RIKEN, Japan and the Core Research for Evolutional Science and Technology (CREST) of Japan Science and Technology Agency (JST)(Y. H.).
Manuscript received November 7, 2006
and in revised form November 27, 2006.
REFERENCES
- Vance, J. E. 2003. Molecular and cell biology of phosphatidylserine and phosphatidylethanolamine metabolism. Prog. Nucleic Acid Res. Mol. Biol. 75: 69111.[Medline]
- Emoto, K., and M. Umeda. 2000. An essential role for a membrane lipid in cytokinesis: regulation of contractile ring disassembly by redistribution of phosphatidylethanolamine. J. Cell Biol. 149: 12151224.[Abstract/Free Full Text]
- Dobrosotskaya, I. Y., A. C. Seegmiller, M. S. Brown, J. L. Goldstein, and R. B. Rawson. 2002. Regulation of SREBP processing and membrane lipid production by phospholipids in Drosophila. Science. 296: 879883.[Abstract/Free Full Text]
- Bogdanov, M., M. Umeda, and W. Dowhan. 1999. Phospholipid-assisted refolding of an integral membrane protein. Minimum structural features for phosphatidylethanolamine to act as a molecular chaperone. J. Biol. Chem. 274: 1233912345.[Abstract/Free Full Text]
- Kuge, O., M. Nishijima, and Y. Akamatsu. 1991. A cloned gene encoding phosphatidylserine decarboxylase complements the phosphatidylserine biosynthetic defect of a Chinese hamster ovary cell mutant. J. Biol. Chem. 266: 63706376.[Abstract/Free Full Text]
- Kennedy, E. P., and S. B. Weiss. 1956. The function of cytidine coenzymes in the biosynthesis of phospholipids. J. Biol. Chem. 222: 193214.[Free Full Text]
- Vance, J. E., and D. E. Vance. 1988. Does rat liver Golgi have the capacity to synthesize phospholipids for lipoprotein secretion? J. Biol. Chem. 263: 58985908.[Abstract/Free Full Text]
- Hjelmstad, R. H., and R. M. Bell. 1991. sn-1,2-Diacylglycerol choline and ethanolaminephosphotransferases in Saccharomyces cerevisiae. Nucleotide sequence of the EPT1 gene and comparison of the CPT1 and EPT1 gene products. J. Biol. Chem. 266: 50945103.[Abstract/Free Full Text]
- Henneberry, A. L., and C. R. McMaster. 1999. Cloning and expression of a human choline/ethanolaminephosphotransferase: synthesis of phosphatidylcholine and phosphatidylethanolamine. Biochem. J. 339: 291298.
- Kikuno, R., T. Nagase, M. Nakayama, H. Koga, N. Okazaki, D. Nakajima, and S. Ohara. 2004. HUGE: a database for human KIAA proteins, a 2004 update integrating HUGEppi and ROUGE. Nucleic Acids Res. 32: D502D504.[Abstract/Free Full Text]
- Kryukov, G. V., S. Castellano, S. V. Novoselov, A. V. Lobanov, O. Zehtab, R. Guigo, and V. N. Gladyshev. 2003. Characterization of mammalian selenoproteomes. Science. 300: 14391443.[Abstract/Free Full Text]
- Hofmann, K., and W. Stoffel. 1993. TMbasea database of membrane spanning protein segments. Biol. Chem. Hoppe Seyler. 374: 166177.
- Mancini, A., F. Del Rosso, R. Roberti, P. Orvietani, L. Coletti, and L. Binaglia. 1999. Purification of ethanolaminephosphotransferase from bovine liver microsomes. Biochim. Biophys. Acta. 1437: 8092.[Medline]
- Yamasaki, M., K. Yamada, S. Furuya, J. Mitoma, Y. Hirabayashi, and M. Watanabe. 2001. 3-Phosphoglycerate dehydrogenase, a key enzyme for L-serine biosynthesis, is preferentially expressed in the radial glia/astrocyte lineage and olfactory ensheathing glia in the mouse brain. J. Neurosci. 21: 76917704.[Abstract/Free Full Text]
- Hannun, Y. A., C. Luberto, and K. M. Argraves. 2001. Enzymes of sphingolipid metabolism: from modular to integrative signaling. Biochemistry. 40: 48934903.[CrossRef][Medline]
- Steenbergen, R., T. S. Nanowski, A. Beigneux, A. Kulinski, S. G. Young, and J. E. Vance. 2005. Disruption of the phosphatidylserine decarboxylase gene in mice causes embryonic lethality and mitochondrial defects. J. Biol. Chem. 280: 4003240040.[Abstract/Free Full Text]

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Signorell, M. Rauch, J. Jelk, M. A. J. Ferguson, and P. Butikofer
Phosphatidylethanolamine in Trypanosoma brucei Is Organized in Two Separate Pools and Is Synthesized Exclusively by the Kennedy Pathway
J. Biol. Chem.,
August 29, 2008;
283(35):
23636 - 23644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Vance
Thematic Review Series: Glycerolipids. Phosphatidylserine and phosphatidylethanolamine in mammalian cells: two metabolically related aminophospholipids
J. Lipid Res.,
July 1, 2008;
49(7):
1377 - 1387.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
Advertisement
Advertisement
|