Advertisement
Research Articles| Volume 59, ISSUE 4, P635-645, April 2018

Adenylyl cyclase 1 as a major isoform to generate cAMP signaling for apoA-1-mediated cholesterol efflux pathway

  • Author Footnotes
    1 The authors W.T. and W.M. contributed equally to the study.
    Wanze Tang
    Footnotes
    1 The authors W.T. and W.M. contributed equally to the study.
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Author Footnotes
    1 The authors W.T. and W.M. contributed equally to the study.
    Weilie Ma
    Footnotes
    1 The authors W.T. and W.M. contributed equally to the study.
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Hang Ding
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Margarita Lin
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Le Xiang
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Guorong Lin
    Correspondence
    To whom correspondence should be addressed.
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Zhizhen Zhang
    Correspondence
    To whom correspondence should be addressed.
    Affiliations
    Department of Biochemistry and Molecular Biology, Guangdong Medical University, Dongguan, Guangdong, China 523808
    Search for articles by this author
  • Author Footnotes
    1 The authors W.T. and W.M. contributed equally to the study.
Open AccessPublished:January 14, 2018DOI:https://doi.org/10.1194/jlr.M082297
      HDL apoA-1-mediated cholesterol efflux pathway requires multiple cellular proteins and signal transduction processes, including adenylyl cyclase (AC)/cAMP signaling. Due to the existence of multiple transmembrane AC isoforms, it was not known how many AC isoforms are expressed and which ones are essential for cholesterol efflux in macrophage foam cells. These questions were investigated in THP-1 macrophages in this study. Quantitative RT-PCR detected mRNAs for all nine transmembrane AC isoforms, but only the mRNA and protein of the AC1 isoform were consistently upregulated by cholesterol loading and apoA-1. AC1 shRNA interference decreased AC1 mRNA and protein levels, resulting in reduction of apoA-1-mediated cAMP production and cholesterol efflux, while the intracellular cholesterol levels remained high. Confocal microscopy showed that apoA-1 promoted translocation of cholesterol and formation of cholesterol-apoA-1 complexes (protrusions) on the cholesterol-loaded macrophage surface. AC1 shRNA-interfered macrophages showed no translocation of cholesterol to the cell surface. AC1 shRNA interference also disrupted cellular localization of the intracellular cholesterol indicator protein adipophillin, and the expression as well as surface translocation of ABCA1. Together, our results show that AC1 is a major isoform for apoA-1-activated cAMP signaling to promote cholesterol transport and exocytosis to the surface of THP-1 macrophage foam cells.
      HDLs are one of the major cholesterol carriers in human plasma, and their levels are inversely correlated with the prevalence of atherosclerotic cardiovascular diseases (
      • Gordon T.
      • Castelli W.P.
      • Hjortland M.C.
      • Kannel W.B.
      • Dawber T.R.
      High density lipoprotein as a protective factor against coronary heart disease. The Framingham Study.
      ). Every milligram increase of HDL may reduce the mortality rate of cardiovascular disease by approximately 2 to 4 percent (
      • Gordon D.J.
      • Probstfield J.L.
      • Garrison R.J.
      • Neaton J.D.
      • Castelli W.P.
      • Knoke J.D.
      • Jacobs Jr., D.R.
      • Bangdiwala S.
      • Tyroler H.A.
      High-density lipoprotein cholesterol and cardiovascular disease. Four prospective American studies.
      ). The beneficial effect is in part attributed to the role of HDL apolipoproteins (mainly apoA-1) in promoting cholesterol removal from macrophage foam cells, leading to reduction of intracellular lipid accumulation and the risk of ischemic cardiovascular disease.
      The HDL apolipoprotein-mediated cholesterol removal pathway involves many cellular proteins, including cell surface binding proteins/receptors (
      • Nofer J.R.
      Signal transduction by HDL: agonists, receptors, and signaling cascades.
      ,
      • Fidge N.H.
      High density lipoprotein receptors, binding proteins, and ligands.
      ), intracellular signal transduction (
      • Nofer J.R.
      Signal transduction by HDL: agonists, receptors, and signaling cascades.
      ,
      • Mineo C.
      • Shaul P.W.
      Regulation of signal transduction by HDL.
      ), vesicle transport (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ,
      • Mendez A.J.
      • Uint L.
      Apolipoprotein-mediated cellular cholesterol and phospholipid efflux depend on a functional Golgi apparatus.
      ), and exocytotic components (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ,
      • Lin G.
      • Oram J.F.
      Apolipoprotein binding to protruding membrane domains during removal of excess cellular cholesterol.
      ). Of these, signal transduction is one of the most complex events, which includes the activation of adenylyl cyclase and cAMP generation (
      • Haidar B.
      • Denis M.
      • Krimbou L.
      • Marcil M.
      • Genest Jr, J.
      cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts.
      ,
      • Haidar B.
      • Denis M.
      • Marcil M.
      • Krimbou L.
      • Genest Jr, J.
      Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter.
      ), activation of Cdc 42 (
      • Nofer J.R.
      • Feuerborn R.
      • Levkau B.
      • Sokoll A.
      • Seedorf U.
      • Assmann G.
      Involvement of Cdc42 signaling in apoA-I-induced cholesterol efflux.
      ), G protein (
      • Kimura T.
      • Sato K.
      • Malchinkhuu E.
      • Tomura H.
      • Tamama K.
      • Kuwabara A.
      • Murakami M.
      • Okajima F.
      High-density lipoprotein stimulates endothelial cell migration and survival through sphingosine 1-phosphate and its receptors.
      ), Rac GTPase (
      • Utech M.
      • Hobbel G.
      • Rust S.
      • Reinecke H.
      • Assmann G.
      • Walter M.
      Accumulation of RhoA, RhoB, RhoG, and Rac1 in fibroblasts from Tangier disease subjects suggests a regulatory role of Rho family proteins in cholesterol efflux.
      ), Janus kinase 2 (
      • Tang C.
      • Vaughan A.M.
      • Oram J.F.
      Janus kinase 2 modulates the apolipoprotein interactions with ABCA1 required for removing cellular cholesterol.
      ), c-Jun N-terminal kinases and p38 MAP kinase (
      • Nofer J.R.
      • Feuerborn R.
      • Levkau B.
      • Sokoll A.
      • Seedorf U.
      • Assmann G.
      Involvement of Cdc42 signaling in apoA-I-induced cholesterol efflux.
      ), protein kinase A (PKA) (
      • Haidar B.
      • Denis M.
      • Marcil M.
      • Krimbou L.
      • Genest Jr, J.
      Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter.
      ), protein kinase C (
      • Mendez A.J.
      • Oram J.F.
      • Bierman E.L.
      Protein kinase C as a mediator of high density lipoprotein receptor-dependent efflux of intracellular cholesterol.
      ), and phospholipase C and D (
      • Walter M.
      • Reinecke H.
      • Gerdes U.
      • Nofer J.R.
      • Hobbel G.
      • Seedorf U.
      • Assmann G.
      Defective regulation of phosphatidylcholine-specific phospholipases C and D in a kindred with Tangier disease. Evidence for the involvement of phosphatidylcholine breakdown in HDL-mediated cholesterol efflux mechanisms.
      ), as well as intracellular calcium release (
      • Takahashi Y.
      • Smith J.D.
      Cholesterol efflux to apolipoprotein AI involves endocytosis and resecretion in a calcium-dependent pathway.
      ). How exactly these proteins and signal mediators facilitate cholesterol removal from cells remains ambiguous. We have investigated a hypothesis exploring whether apoA-1 promotes vesicle transport and exocytosis of cholesterol by activation of intracellular signal transduction through some of the proteins and kinases mentioned above (
      • Lin G.
      Insights of high-density lipoprotein apolipoprotein-mediated lipid efflux from cells.
      ).
      Adenylyl cyclase is also known as adenyl cyclase and adenylate cyclase (AC), and this enzyme catalyzes the conversion of ATP to 3′, 5′-cyclic AMP (cAMP), a universal second messenger that regulates diverse cellular functions including secretion and exocytosis (
      • Sadana R.
      • Dessauer C.W.
      Physiological roles for G protein-regulated adenylyl cyclase isoforms: insights from knockout and overexpression studies.
      ). Structurally, AC consists of a 120 kDa catalytic subunit and a 50 kDa regulatory subunit, with a total of 10 isoforms found in mammalian tissues. Isoforms 1 to 9 are localized on the cell membrane and are called the transmembrane adenylyl cyclases, which are activated by G protein-coupled receptors (
      • Sadana R.
      • Dessauer C.W.
      Physiological roles for G protein-regulated adenylyl cyclase isoforms: insights from knockout and overexpression studies.
      ). Isoform 10 is a soluble adenylyl cyclase found in the cytosol, nucleus, mitochondria, and centriole (
      • Hokland B.M.
      • Slotte J.P.
      • Bierman E.L.
      • Oram J.F.
      Cyclic AMP stimulates efflux of intracellular sterol from cholesterol-loaded cells.
      ). HDL and apoA-1 activate adenylyl cyclase and increase cAMP level, which results in PKA activation and cholesterol efflux (
      • Haidar B.
      • Denis M.
      • Krimbou L.
      • Marcil M.
      • Genest Jr, J.
      cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts.
      ,
      • Haidar B.
      • Denis M.
      • Marcil M.
      • Krimbou L.
      • Genest Jr, J.
      Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter.
      ). PKA inhibitors, such as H89, significantly decrease HDL and apoA-1-mediated cholesterol efflux (
      • Haidar B.
      • Denis M.
      • Krimbou L.
      • Marcil M.
      • Genest Jr, J.
      cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts.
      ,
      • Haidar B.
      • Denis M.
      • Marcil M.
      • Krimbou L.
      • Genest Jr, J.
      Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter.
      ,
      • Hokland B.M.
      • Slotte J.P.
      • Bierman E.L.
      • Oram J.F.
      Cyclic AMP stimulates efflux of intracellular sterol from cholesterol-loaded cells.
      ). These observations suggest the AC/cAMP/PKA signaling cascade is required for HDL apolipoprotein-mediated cholesterol efflux pathway. Although AC isoform expressions have been reported in macrophages from liver and lung (
      • Risøe P.K.
      • Wang Y.
      • Stuestol J.F.
      • Aasen A.O.
      • Wang J.E.
      • Dahle M.K.
      Lipopolysaccharide attenuates mRNA levels of several adenylyl cyclase isoforms in vivo.
      ), it is known how many AC isoforms are expressed in macrophage foam cells, the principal components in atherosclerotic lesions, and which AC isoform(s) is required for apoA-1 mediated cholesterol efflux in foam cells is also unknown. We investigated these questions by using quantitative (q)RT-PCR screening, shRNA interference, biochemical analysis, and confocal microscopy in this study. Here, we report that AC1 is a major isoform activated by apoA-1 to promote cholesterol efflux from THP-1 macrophage foam cells.

      MATERIALS AND METHODS

      Cell culture and cholesterol loading with ac-LDL

      Human monocytic THP-1 was obtained from ATCC and maintained in RPMI 1640 media according to instructions from the source. For the experiments, the cells were plated in culture dishes or microscope cover slips, and induced by 160 nM PMA for 48 h to differentiate into macrophages. The cells were then incubated with 50 μg/ml acLDL for 48 h to become cholesterol-loaded macrophage foam cells, whereas control cells were incubated without acLDL in the same media as described in our recent study (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ).

      Relative qRT-PCR analysis

      Total RNA was extracted using Trizol reagent (Life Technologies, Grand Island, NY) according to the manufacturer's instructions. qRT-PCR was conducted in ABI 7500 Real-Time PCR system from Applied Biosystems (Life Technologies) with reagents obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). Total RNA (300 ng) from each condition was used for the first strand synthesis. PCR cycles were performed with specific primers at the following conditions: 95°C for 30 s, 95°C for 5 s, and 60°C for 34 s with 40 cycles, 95°C for 15 s and 60°C for 1 min and 95°C for 15 s with one cycle. Primers for AC1, AC4, and GAPDH were listed in Table 1. The primers for the rest of the AC isoforms used the sequences as described in reference (
      • Nakano S.J.
      • Sucharov J.
      • van Dusen R.
      • Cecil M.
      • Nunley K.
      • Wickers S.
      • Karimpur-Fard A.
      • Stauffer B.L.
      • Miyamoto S.D.
      • Sucharov C.C.
      Cardiac adenylyl cyclase and phosphodiesterase expression profiles vary by age, disease, and chronic phosphodiesterase inhibitor treatment.
      ).
      TABLE 1qRT-PCR primer sequences
      AC15′ AGGATGAGAACGAGAAGCAGGAG 3′ (forward)
      5′ ACCCACGATGTCAGCAAACAGGAT 3′ (reverse)
      AC45′ CTTCCTCCTCTTCCTCCTCATCC 3′ (forward)
      5′ GGCTATTCTCAGTC CTGGTCGTG 3′ (reverse)
      GAPDH5′ GTCTCCTCTGACTTCAACAGCG 3′ (forward)
      5′ ACCACCCTGTTGCTGTAGCCAA 3′ (reverse)

      Construction of shRNA lentiviral particles and transduction

      The human adenylyl cyclase AC1, AC4, and scrambled shRNA oligonucleotides were synthesized by Genomeditech Co., Ltd (Shanghai, China) as listed in Table 2. The synthetic shRNA fragments, with BamHI and EcoRI restriction sites at 5′ and 3′ ends respectively, were cloned into pGMLV-SC1 RNAi lentiviral vectors. The shRNA lentiviral particles were generated and transduced into the THP-1 cells by using the lentiviral particles 30 optimal multiplicity of infection as described in our recent study (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ).
      TABLE 2shRNA interference sequences
      AC15′gatccGCTAGTATTCTGCATCTGCTTCCTCGAGGAAGCAGATGCAGAATACTAGCTTTTTTg 3′ (forward)
      5′aattcAAAAAAGCTAGTATTCTGCATCTGCTTCCTCGAGGAAGCAGATGCAGA ATACTAGCg 3′ (reverse)
      AC45′gatccCCGGCCTACCTATCTGGTCATCGATCTCGAGATCGATGACCAGATAGGTAGGTTTTTg 3′ (Forward)
      5′aattcAAAAACCTACCTATCTGGTCATCGATCACGAGATCGATGACCAGATAGGTAGGCCGGg 3′ (Reverse)
      Scrambled5′gatccGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGA­GAACT­TTT­TTAC­G­CGTg 3′ (forward)
      5′aattcACGCGTAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTT­CGG­AG­AACg 3′ (reverse)

      Cellular cAMP and total cholesterol determination

      To determine cellular cAMP levels, macrophages foam cells were treated with or without 10 μg/ml apoA-1 for 10 min. The culture media were removed, and the cells were rapidly washed with PBS buffer. The resulting cells were lysed with 0.1M HCl and centrifuged at 10,000 g for 10 min at 4°C to obtain supernatant fractions. The supernatant was assayed in duplicate using Cyclic AMP EIA Kit from Cayman Chemical Co. (Ann Arbor, MI) according to the manufacturer's instructions. The protein concentration was determined in the same supernatants by using the Biorad Protein Assay Kit. Final cAMP concentration was expressed as pmol/mg protein (mean ± SD of three separate experiments). To determine cellular cholesterol, the macrophage foam cells were treated with or without 10 μg/ml apoA-1 for 6 h. The culture media were then removed, and the cells were washed three times with PBS. The resulting cells were lysed, and total cholesterol was assayed in duplicate with an assay kit (Applygen Technologies Inc. Beijing, China) according to the manufacturer's instructions. The protein concentration was determined in the same lysate by Biorad Protein Assay Kit. Total cellular cholesterol was expressed as nmol/ mg protein (mean± SD of three to four individual experiments).

      Cholesterol efflux assay

      Macrophages were simultaneously labeled and loaded in RPMI media containing 0.2 μCi [3H] cholesterol (10.5 Ci/mmol, Shanghai Atomic Institute, Chinese Academy of Sciences, Shanghai, China), 50 μg/ml acLDL, and 2 mg/ml BSA for 48 h (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ). The resulting cells were subsequently subjected to equilibration in RPMI media contained 2 mg/ml BSA for 24 h. The cells were then incubated in fresh RPMI medium with or without 10 μg/ml apoA-1 for 6 h. Levels of [3H] cholesterol were separately determined in the efflux media and the cells by using a scintillation counter. Cholesterol efflux (%) was calculated as the cpm in the efflux media divided by the total cpm (media plus cells) and multiplied by 100%. Net apoA-1-mediated cholesterol efflux was obtained by subtracting efflux of control cells from that of the cells incubated with apoA-1.

      Western blotting analysis

      THP-1 macrophage-derived foam cells were treated as indicated in figure legends and total cellular protein was extracted with RIPA buffer (Beyotime Institute of Biotechnology, Beijing, China), and equal amounts of protein were separated by 10% SDS-PAGE and transferred electrophoretically to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Western blotting was carried out with a standard protocol using rabbit polyclonal antibodies of AC1 andAC4 (both at 1:500 dilutions) from Abnova (Taipei, China), followed by goat anti-rabbit IgG-HRP (1:1000 dilutions) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Protein bands were detected with ECL and were quantified with Molecular Imager ChemiDoc XRS+ System (Bio-Rad, Wuhan, China).

      Confocal microscopy

      THP-1 macrophages either transduced by AC1 shRNA, scrambled lentivirus, or controls were cultured on glass cover slips. The cells were loaded with or without 50 μg/ml acLDL for 48 h, treated with or without 10 μg/ml apoA-1 for 6 h, then washed for 5 min with PBS twice to remove unbound apoA-1. The cells were fixed in 4% paraformaldehyde in PBS for 20 min, and then washed three times with PBS for 10 min each to remove free fixative before being labeled with different probes. For detection of apoA-1 and cholesterol colocalization on the cell surface, cells were incubated in 5% BSA in PBS containing anti-apoA-1 antibody (1:400 dilutions from Abcam) at room temperature for 1 h and washed three times with PBS for 10 min each. The cells were subsequently incubated with goat anti-rabbit Alexa 568-conjugated secondary antibody (1:1000 dilutions from Abcam) and a cholesterol probe filipin III at 50 μg/ml (Cayman Chemical) for 1 h at room temperature. Subsequently, the cells were washed three times with PBS for 10 min each. The cells in cover slips were mounted with ProLong® antifade reagents and cured for at least 48 h before examination with confocal microscopy. For visualization of intracellular protein targets, the fixed cells in cover slips were simultaneously permeabilized and blocked in PBS containing 5% BSA and 0.1% NP 40 for 45 min as described in our recent study (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ). The cells were incubated either with a rabbit anti-adipophillin (ADFP) or anti-ABCA1 antibody (1:100 dilutions, both from Abcam) at 4°C overnight, and then washed three times for 10 min each with PBS containing 5% BSA and 0.1% NP 40. The cells were incubated with goat anti-rabbit secondary antibody-conjugated with Alexa 568 (1:1000 dilutions, Abcam) for 1 h at room temperature, and then washed three times with PBS for 10 min each at room temperature. The cover slips containing the processed cells were mounted with ProLong® antifade reagents as mentioned above. All samples were examined with a confocal laser-scanning microscope with an excitation laser corresponding to optimal wavelength of the probes (Zeiss LSM 710, Germany). The images were acquired and processed with Zen® software (Zeiss, Germany). Fiji (Image J) was used to determine the corrected cell fluorescence according to the method of McCloy and Burgess (
      • McCloy R.A.
      • Rogers S.
      • Caldon C.E.
      • Lorca T.
      • Castro A.
      • Burgess A.
      Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events.
      ,
      • Burgess A.
      • Vigneron S.
      • Brioudes E.
      • Labbe J.C.
      • Lorca T.
      • Castro A.
      Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance.
      ).

      Statistical analysis

      Statistical analysis was performed using one-way ANOVA with GraphPad Prism (GraphPad Software) followed by the Newman-Keuls multiple comparisons test. The level of significance was set at P < 0.05 for all results.

      RESULTS

      AC1 as a major isoform upregulated by cholesterol and apoA-1

      Real-time qRT-PCR expression profiling showed that mRNAs of all transmembrane adenylyl cyclases were detected in THP-1 macrophages. AC1, AC3, and AC4 mRNAs were significantly upregulated by cholesterol loading, and the mRNA levels of AC1 to AC4 were increased by apoA-1 (Fig. 1A). Of these, AC1 mRNA levels had the greatest response to ac-LDL cholesterol loading and apoA-1 stimulation. Western blotting confirmed that AC1 protein levels were also increased by cholesterol loading and apoA-1 (Fig. 1B). Thus, our next studies were focused on the characterization of AC1 in the cholesterol efflux process, because the protein levels of other isoforms were not consistently influenced by cholesterol loading and apoA-1.
      Figure thumbnail gr1
      Fig. 1AC isoform expressions in THP-1 macrophages. THP-1 macrophages were prepared and total RNA was extracted for qRT-PCR as described in Materials and Methods. A: Relative mRNA levels for each transmembrane AC isoform. ** and ***, P < 0.01 and P < 0.001, respectively, compared with control. ##, P < 0.01 compared with the ac-LDL loaded cells. B: AC1 protein levels determined by Western blotting under the same conditions, with GAPDH as a loading control. ***, P < 0.001 compared with control; ##, P < 0.01 compared with the ac-LDL loaded cells. The experiments were repeated four times. ac-LDL, macrophages loaded with ac-LDL; apoA-1, macrophages loaded with ac-LDL and then incubated with apoA-1.

      Reduction of cAMP production and cholesterol efflux by AC1 shRNA interference

      To establish functional relevance of the AC1 isoform with apoA-1-mediated cholesterol efflux, AC1 shRNA was used to interfere with AC1 expression, and then its effects on the cholesterol efflux process were determined. To begin, the mRNA and protein levels of the target were determined to ensure reduction of the isoform following AC1 shRNA interference in THP-1 macrophages. qRT-PCR showed that AC1 shRNA interference reduced AC1 mRNA by 75% compared with control, and by more than 90% when compared with that of apoA-1 or scrambled shRNA interfered cells due to the higher level of AC1 in the two groups (Fig. 2A). The AC1 protein levels in the AC1 shRNA interfered cells were reduced by 45% to 55% when compared with control, A-1-treated cells, or scrambled shRNA control (Fig. 2B), suggesting that AC1 protein turnover was slower than that of AC1 mRNA. Functionally, both cAMP level and apoA-1-mediated cholesterol efflux were greatly reduced in the AC1 silenced macrophages after incubation with apoA-1, in comparison to those in the nonshRNA interfered macrophages and in scrambled shRNA interfered macrophages (Fig. 2C, D). In contrast, the intracellular cholesterol level was significantly higher in the AC1 shRNA interfered cells than that in nonshRNA treated cells or scrambled shRNA interfered cells (Fig. 2E). As an additional control, we investigated whether AC4 shRNA interference could influence cAMP production and cholesterol efflux in THP-1 macrophages in response to apoA-1 stimulation, but no consistent effects on these two parameters were observed even though AC4 shRNA effectively reduced the levels of AC4 mRNA and protein (Fig. 3). Taken together, the results indicated that AC1 was the major isoform responsible for apoA-1-activated cAMP production and subsequent cholesterol efflux from cholesterol-loaded macrophages.
      Figure thumbnail gr2
      Fig. 2Effects of AC1 shRNA interference on cAMP levels and cholesterol efflux. All macrophages except the control were loaded with ac-LDL cholesterol and incubated with apoA-1 for the experiment. A: AC1 mRNA levels determined by qRT-PCR. ***, P < 0.001 compared with control. ###, P < 0.001 compared with the A-1 and scrambled shRNA groups. B: AC1 protein expression determined by Western blotting with GAPDH as a loading control. **, P < 0.01 compared with control; ***, P < 0.001 compared with all. C: cAMP levels in control and AC1 shRNA transduced cell groups. ***, P < 0.001 compared with the A-1 and scrambled shRNA groups. No difference was seen between control and AC1 shRNA silenced cells. D: ApoA-1-mediated cholesterol efflux. ***, P < 0.001 compared with the A-1 and scrambled shRNA groups. No difference between control and AC1 shRNA silenced cells. E: The levels of intracellular cholesterol. **, P < 0.01 compared with the A-1 and scrambled shRNA groups. No difference between control and AC1 shRNA silenced cells. Con, A-1, AC1, and Scr represent control, apoA-1 incubation, AC1 shRNA, and scrambled shRNA interfered macrophages, respectively. The experiments were repeated four times.
      Figure thumbnail gr3
      Fig. 3AC4 shRNA interference on cAMP production and cholesterol efflux. All macrophages except the control were loaded with ac-LDL cholesterol and incubated with apoA-1 for the experiment. A: AC4 mRNA levels. The symbol *** represents P < 0.001 compared with control. The symbol ### represents P < 0.001 compared with the A-1 and scrambled shRNA groups. B: AC4 protein expression. GAPDH was used as loading control. The symbol *** represents P < 0.001 compared with all other groups. C: cAMP levels in AC4 shRNA transduced and other groups. The symbol *** indicates P < 0.001 compared with control. No difference among the A-1, AC4 shRNA, and scrambled shRNA groups. D: apoA-1-mediated cholesterol efflux. Con, A-1, AC4, and Scr represent control, apoA-1 treated alone, AC4 shRNA interference, and scrambled shRNA interfered cells, respectively. The experiments were repeated four times.

      Reduction of cholesterol translocation to the cell surface by AC1 shRNA interference

      Prior studies with immunogold electron microscopy and biochemical analysis show that apoA-1 binding to the cell membrane promotes cholesterol transport and secretion of lipids to form lipid protrusion complexes on the cell surface (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ,
      • Lin G.
      • Oram J.F.
      Apolipoprotein binding to protruding membrane domains during removal of excess cellular cholesterol.
      ,
      • Vedhachalam C.
      • Duong P.T.
      • Nickel M.
      • Nguyen D.
      • Dhanasekaran P.
      • Saito H.
      • Rothblat G.H.
      • Lund-Katz S.
      • Phillips M.C.
      Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.
      ). However, these studies have not directly shown colocalization of cholesterol and apoA-1 in the lipid complexes on the cell surface. Here, we investigated whether it was possible to observe colocalization of cholesterol and apoA-1 on the surface lipid protrusion complexes and whether AC1 shRNA interference would affect the appearance of the complex, by using laser scanning confocal microscopy. Filipin III, an antibiotic from Streptomyces filipinensis, was used as a cholesterol probe because it selectively binds to cholesterol and produces blue fluorescence upon excitation (
      • Castanho M.A.
      • Coutinho A.
      • Prieto M.J.
      Absorption and fluorescence spectra of polyene antibiotics in the presence of cholesterol.
      ). Confocal images showed that ac-LDL-loaded macrophages had an increased level of blue fluorescence from filipin III, an indication of higher levels of intracellular cholesterol, in comparison to nonac-LDL loaded macrophages, which had lesser blue fluorescence (Fig. 4, control and Ac-LDL panels) . The macrophages incubated with apoA-1 were observed with red fluorescence surrounding the cell surface. A majority of apoA-1 was located on the smooth cell membrane, and some was also located in the surface complexes consisting of red fluorescence from apoA-1 around the outer layer and blue coloration from cholesterol content within, as indicated by arrows (Fig. 4, apoA-1 panel). Overall levels of blue fluorescence from filipin III were reduced in the macrophages incubated with apoA-1, indicating that apoA-1 promoted cholesterol efflux and reduced amounts of the intracellular cholesterol in these cells (Fig. 4, apoA-1 panel). In the AC1 shRNA interfered macrophages, blue fluorescence from filipin remained high and apoA-1 appeared on the relatively smooth cell surface with few protrusion complexes (Fig. 4, AC1 shRNA +apoA-1 panel). Following incubation of the scrambled shRNA interfered cells with apoA-1, the intracellular cholesterol (indicated by filipin fluorescence) decreased and the protrusion complexes were also observed, which were similar to those in nonshRNA interfered macrophages incubated with apoA-1 (Fig. 4, scrambled + apoA-1 panel). Thus, confocal microscopy was able to clearly demonstrate that apoA-1 promoted formation of the lipid complex protrusion on the membrane surface of nonshRNA and scrambled shRNA interfered cells. Quantification of filipin fluorescence reflected changes in intracellular cholesterol as expected (Fig. 4, fluorescence intensity panel). These results were consistent with the idea that AC1 is the major isoform for apoA-1-activated production of the second messenger cAMP to promote cholesterol efflux to the cell surface.
      Figure thumbnail gr4
      Fig. 4Localization of cholesterol and apoA-1 in macrophages observed by confocal microscopy. Macrophages were prepared in glass cover slips, and all cells except the control were loaded with ac-LDL cholesterol for confocal microscopy study. Blue filipin fluorescence represents cellular cholesterol and red fluorescence indicates apoA-1 binding to the cell surface. Control panel: control macrophages. Ac-LDL panel: macrophages loaded with ac-LDL cholesterol. ApoA-1 panel: macrophages incubated with apoA-1. Red arrows indicate cholesterol and apoA-1 complexes (protrusions) on the cell surface in which cholesterol (blue fluorescence) was encircled by apoA-1 (red fluorescence). AC1 shRNA + apoA-1 panel: macrophages with AC1 shRNA plus apoA-1. ApoA-1 was localized on relatively smooth cell surface without the cholesterol complex. Scrambled shRNA + apoA-1: macrophages with scrambled shRNA plus apoA-1. Cholesterol and apoA-1 complex are visible on the cell surface. Scale bar represents 5 µm in all images. The experiments were repeated three times and representative images are shown. Fluorescence intensity panel: quantification of filipin fluorescence. Each bar represents mean of the corrected cell filipin fluorescence from 80 to 100 cells from the three separate experiments. ***, P < 0.001 compared with the control, ApoA-1, or Scrambled shRNA+ apoA-1 groups.

      ADFP distribution in AC1 shRNA interfered cells

      ADFP is a lipid droplet coat protein located on the outermost monolayer of lipid droplets (
      • Robenek H.
      • Robenek M.J.
      • Troyer D.
      PAT family proteins pervade lipid droplet cores.
      ), and a specific marker of lipid accumulation in THP-1 macrophages and atherosclerotic lesions (
      • Heid H.W.
      • Moll R.
      • Schwetlick I.
      • Rackwitz H.R.
      • Keenan T.W.
      Adipophilin is a specific marker of lipid accumulation in diverse cell types and diseases.
      ,
      • Larigauderie G.
      • Furman C.
      • Jaye M.
      • Lasselin C.
      • Copin C.
      • Fruchart J.C.
      • Castro G.
      • Rouis M.
      Adipophilin enhances lipid accumulation and prevents lipid efflux from THP-1 macrophages: potential role in atherogenesis.
      ). ADFP is also associated with cholesterol transport vesicles in the process of apoA-1-mediated cholesterol efflux (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ). If ADFP is localized in the downstream of apoA-1 activated cAMP signaling pathway, we would expect to see the cellular distribution of ADFP changed, and potential alterations could be detected by confocal microscopy. As shown in the previous study (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ), cholesterol loading increased ADFP level with punctate distribution in cytoplasm (Fig. 5, control and Ac-LDL panels). ADFP levels were dramatically reduced in apoA-1 incubated nonshRNA and scrambled interfered macrophages (Fig. 5, apoA-1 and scrambled + apoA-1 panels). In AC1 shRNA silenced macrophages, ADFP level remained high and appeared in the cytoplasm and nucleus (Fig. 5, AC1 shRNA+ apoA-1 panel). Quantification of ADFP levels was also consistent with accumulation of intracellular cholesterol (Fig. 5, fluorescence intensity panel). Unexpectedly, AC1 was found to be required for maintaining normal cellular distribution of ADFP.
      Figure thumbnail gr5
      Fig. 5AC1 shRNA interference on expression and cellular localizations of ADFP in macrophages observed with confocal microscopy. Macrophages, except the control, were loaded with ac-LDL cholesterol for confocal microscopy study as in . Red fluorescence represents ADFP and blue fluorescence indicates a nucleus stained by DAPI. Control panel: control macrophages. Ac-LDL panel: macrophages loaded with ac-LDL cholesterol. Intense red fluorescence with punctate distribution in cytoplasm showed accumulation of intracellular cholesterol. ApoA-1 panel: macrophages incubated with apoA-1 only. AC1 shRNA + apoA-1 panel: macrophages with AC1 shRNA interference plus apoA-1. Scrambled shRNA + apoA-1 panel: macrophages with scrambled shRNA interference plus apoA-1. Scale bar represented 5 µm in all images. The experiments were repeated three times and representative images are shown. Fluorescence intensity panel: quantification of ADFP levels. Each bar represents mean of the corrected cell fluorescence from 80 to 100 cells from three separate experiments. ** and ***, P < 0.01 and P < 0.001 respectively, compared with the control, ApoA-1, or Scrambled shRNA+ apoA-1 groups. ##, P < 0.01 compared with the Ac-LDL group.

      Effect of AC1 shRNA interference on ABCA1 levels and localizations

      ABCA1 is a critical component in apoA-1 mediated cholesterol efflux (
      • Oram J.F.
      HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol.
      ). Studies suggest that ABCA1 is also a component of cholesterol transport vesicles (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ,
      • Lin S.
      • Zhou C.
      • Neufeld E.
      • Wang Y.H.
      • Xu S.W.
      • Lu L.
      • Wang Y.
      • Liu Z.P.
      • Li D.
      • Li C.
      • et al.
      BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein modulates ATP-binding cassette transporter A-1 trafficking and function.
      ). We showed here that cholesterol loading increased ABCA1 levels in cytoplasm, in comparison to the noncholesterol loaded cells (Fig. 6, control and AC-LDL panels). Treatment with apoA-1 increased ABCA1 protein levels in the cytoplasm and cell surface in nonshRNA and scrambled shRNA interfered macrophages (Fig. 6, apoA-1 and scrambled shRNA + apoA-1 panels). AC1 shRNA interference reduced total and membrane ABCA1 (Fig. 6, AC1 shRNA+apoA-1 panel). In line with confocal images, quantification of ABCA1 levels showed that AC1 shRNA interference reduced ABCA1 levels (Fig. 6, fluorescence intensity panel). Together, the results indicate that AC1 is also required for ABCA1 expression and cellular localization.
      Figure thumbnail gr6
      Fig. 6Translocation of ABCA1 to the cell surface observed by confocal microscopy. Macrophages, except the control, were loaded with ac-LDL cholesterol for confocal microscopy study as in Fig. 4, Fig. 5. Red fluorescence represents ABCA1 and blue fluorescence shows nucleus stained by DAPI. Control panel: control macrophages. Ac-LDL panel: macrophages loaded with ac-LDL. ApoA-1 panel: macrophages incubated with apoA-1 only. AC1 shRNA + apoA-1 panel: macrophages with AC1 shRNA interference and incubated with apoA-1. Scrambled shRNA + apoA-1 panel: macrophages with scrambled shRNA interference and apoA-1 incubation. Arrows indicate ABCA1 on the cell surface. Scale bar represents 5 µm in all images. The experiments were repeated three times and representative images are shown. Fluorescence intensity panel: quantification of total cellular ABCA1 levels. Each bar represents the mean of corrected cell fluorescence from 80 to 100 cells from three separate experiments. ** and ***, P < 0.01 and P < 0.001 respectively, compared with the control or AC1 shRNA+ apoA-1 groups. ##, P < 0.01 compared with the Ac-LDL group.

      DISCUSSION

      Activation of ACs produces cAMP as a second messenger that regulates diverse intracellular signaling pathways of important cellular functions, including metabolism, gene expression, cell growth, apoptosis, and secretion (
      • Beavo J.A.
      • Brunton L.L.
      Cyclic nucleotide research–still expanding after half a century.
      ). This study shows for the first time that all nine transmembrane AC isoforms are expressed in THP-1 foam cells, but only AC1 acts as a major signaling “switch” for the apoA-1-mediated cholesterol efflux pathway in lipid-loaded macrophages. Because the HDL apolipoprotein-mediated cholesterol efflux pathway plays a vital role in protecting against cardiovascular diseases, AC1 is a potential target that can be selectively activated to promote cholesterol clearance from foam cells and reduce the risk of ischemic cardiovascular diseases should an AC1-specific agonist become available.
      Findings from multiple approaches in this study support AC1 as the main isoform for the apoA-1-mediated cholesterol efflux pathway in cholesterol-loading macrophage foam cells. We showed that AC1 mRNA and protein levels are upregulated by both cholesterol and apoA-1. AC1 shRNA interference reduces apoA-1-stimulated cAMP production and cholesterol efflux from cells. As a result, the intracellular cholesterol levels remain higher in comparison to nonshRNA and scrambled-shRNA transduced macrophages. In contrast, AC4 shRNA interference has no influence on apoA-1-mediated cAMP production, cholesterol efflux, or intracellular cholesterol levels. We also observed formation of the cholesterol complex (protrusions) with apoA-1 on the cell membrane by confocal microscopy with the double labeling technique, as seen with immunogold electron microscopy (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ,
      • Lin G.
      • Oram J.F.
      Apolipoprotein binding to protruding membrane domains during removal of excess cellular cholesterol.
      ,
      • Vedhachalam C.
      • Duong P.T.
      • Nickel M.
      • Nguyen D.
      • Dhanasekaran P.
      • Saito H.
      • Rothblat G.H.
      • Lund-Katz S.
      • Phillips M.C.
      Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.
      ). No cholesterol or apoA-1 complexes were observed on the cell surface in AC1-silenced macrophages. Taken together, we concluded that AC1 is the major isoform for cAMP production in the apoA-1-mediated cholesterol efflux pathway.
      It is well known that cAMP signaling is compartmentalized by anchoring a specific adenylate cyclase and PKA in particular sites of cytoplasm through scaffold proteins, which results in activation of only a subset of downstream substrates in response to a specific receptor activation (
      • Hayes J.S.
      • Brunton L.L.
      Functional compartments in cyclic nucleotide action.
      ). In addition, compartmentalization of cAMP signaling is enforced by cyclic nucleotide phosphodiesterases (PDEs) that hydrolyse cAMP and limit its diffusion to nearby regions (
      • Conti M.
      • Mika D.
      • Richter W.
      Cyclic AMP compartments and signaling specificity: role of cyclic nucleotide phosphodiesterases.
      ). PDE4 inhibitors rolipram and cilomilast potentiate apoA-1-mediated cholesterol efflux from THP-1 macrophages (
      • Lin G.
      • Bornfeldt K.E.
      Cyclic AMP-specific phosphodiesterase 4 inhibitors promote ABCA1 expression and cholesterol efflux.
      ), suggesting that PDE4 is the isoform participating in compartmentalization of apoA-1-mediated AC1/cAMP signaling within THP-1 macrophages. These mechanisms explain why we observe the formation of apoA-1 and cholesterol complexes in only some areas of the cell surface, as apoA-1-triggered AC1/cAMP signaling is confined to a specific region to promote vesicle transport of cholesterol and exocytosis to the cell surface, resulting in the formation of lipid complexes with apoA-1 (
      • Lin G.
      Insights of high-density lipoprotein apolipoprotein-mediated lipid efflux from cells.
      ).
      ADFP is a protein marker of cholesterol buildup in foam cells of atherosclerotic lesions (
      • Heid H.W.
      • Moll R.
      • Schwetlick I.
      • Rackwitz H.R.
      • Keenan T.W.
      Adipophilin is a specific marker of lipid accumulation in diverse cell types and diseases.
      ,
      • Larigauderie G.
      • Furman C.
      • Jaye M.
      • Lasselin C.
      • Copin C.
      • Fruchart J.C.
      • Castro G.
      • Rouis M.
      Adipophilin enhances lipid accumulation and prevents lipid efflux from THP-1 macrophages: potential role in atherogenesis.
      ). ADFP levels, evaluated by qualitative and quantitative methods, remain high after AC1 shRNA interference, indicating intracellular cholesterol accumulation, which is also consistent with the findings from direct measurement of the cellular cholesterol (Fig. 2E) and quantification of filipin fluorescence (Fig. 4, fluorescence intensity panel). Surprisingly, AC1 shRNA interference also completely changed the ADFP distribution pattern from punctate appearance in cytoplasm to whole cell localization, including nuclear accumulation. This suggests that AC1 is also required for the cellular localization of ADFP, although its cellular functions remain to be determined in the future.
      ABCA1 mutations are the cause of Tangier disease, a rare condition characterized by severe HDL deficiency, cholesterol accumulation in tissue macrophages, and atherosclerosis, due to a defect in the apoA-1-mediated cholesterol efflux process (
      • Oram J.F.
      HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol.
      ). ABCA1 expression is upregulated by cAMP-increasing agents, including forskolin and prostaglandin (
      • Hokland B.M.
      • Slotte J.P.
      • Bierman E.L.
      • Oram J.F.
      Cyclic AMP stimulates efflux of intracellular sterol from cholesterol-loaded cells.
      ,
      • Lin G.
      • Bornfeldt K.E.
      Cyclic AMP-specific phosphodiesterase 4 inhibitors promote ABCA1 expression and cholesterol efflux.
      ), cAMP-specific PDE inhibitors (
      • Hokland B.M.
      • Slotte J.P.
      • Bierman E.L.
      • Oram J.F.
      Cyclic AMP stimulates efflux of intracellular sterol from cholesterol-loaded cells.
      ,
      • Lin G.
      • Bornfeldt K.E.
      Cyclic AMP-specific phosphodiesterase 4 inhibitors promote ABCA1 expression and cholesterol efflux.
      ), as well as cAMP analogs 8-bromo-cyclic AMP (
      • Hokland B.M.
      • Slotte J.P.
      • Bierman E.L.
      • Oram J.F.
      Cyclic AMP stimulates efflux of intracellular sterol from cholesterol-loaded cells.
      ,
      • Smith J.D.
      • Miyata M.
      • Ginsberg M.
      • Grigaux C.
      • Shmookler E.
      • Plump A.S.
      Cyclic AMP induces apolipoprotein E binding activity and promotes cholesterol efflux from a macrophage cell line to apolipoprotein acceptors.
      ,
      • Oram J.F.
      • Lawn R.M.
      • Garvin M.R.
      • Wade D.P.
      ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages.
      ). Mouse cells have better responses to the mentioned agents than those of human cells, because the mouse ABCA1 genome has a strong cAMP-responsive enhancer located in the first intron, which increases ABCA1 expression in response to cAMP levels (
      • Le Goff W.
      • Zheng P.
      • Brubaker G.
      • Smith J.D.
      Identification of the cAMP-responsive enhancer of the murine ABCA1 gene: requirement for CREB1 and STAT3/4 elements.
      ), whereas the human genome has a weak cAMP binding sequence at the −220 to −80 bp within the promoter region to increase ABCA1 expression (
      • Santamarina-Fojo S.
      • Peterson K.
      • Knapper C.
      • Qiu Y.
      • Freeman L.
      • Cheng J.F.
      • Osorio J.
      • Remaley A.
      • Yang X.P.
      • Haudenschild C.
      • et al.
      Complete genomic sequence of the human ABCA1 gene: analysis of the human and mouse ATP-binding cassette A promoter.
      ). ABCA1 is phosphorylated by cAMP-activated PKA to modulate its activity (
      • Haidar B.
      • Denis M.
      • Krimbou L.
      • Marcil M.
      • Genest Jr, J.
      cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts.
      ,
      • Haidar B.
      • Denis M.
      • Marcil M.
      • Krimbou L.
      • Genest Jr, J.
      Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter.
      ). In this study, we showed that apoA-1 increases ABCA1 expression in nonAC1 shRNA transduced cells and scrambled shRNA transduced macrophages. In AC1 shRNA silenced macrophages, reduced cAMP production would lead to decrease ABCA1 expression and apoA-1-mediated cholesterol efflux.
      Functionally, several mechanisms have been proposed to explain how ABCA1 facilitates apoA-1-mediated cholesterol efflux from cells. ABCA1 is considered as an active transporter for cholesterol and phospholipids across the cell membrane because it shares a similar amino acid sequence with other ABC transporters (
      • Vedhachalam C.
      • Duong P.T.
      • Nickel M.
      • Nguyen D.
      • Dhanasekaran P.
      • Saito H.
      • Rothblat G.H.
      • Lund-Katz S.
      • Phillips M.C.
      Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.
      ,
      • Oram J.F.
      HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol.
      ,
      • Nagata K.O.
      • Nakada C.
      • Kasai R.S.
      • Kusumi A.
      • Ueda K.
      ABCA1 dimer-monomer interconversion during HDL generation revealed by single-molecule imaging.
      ). Along with others, we show that ABCA1 functions as a component of cholesterol transport vesicles (
      • Ma W.
      • Lin M.
      • Ding H.
      • Lin G.
      • Zhang Z.
      Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
      ,
      • Lin S.
      • Zhou C.
      • Neufeld E.
      • Wang Y.H.
      • Xu S.W.
      • Lu L.
      • Wang Y.
      • Liu Z.P.
      • Li D.
      • Li C.
      • et al.
      BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein modulates ATP-binding cassette transporter A-1 trafficking and function.
      ,
      • Neufeld E.B.
      • Remaley A.T.
      • Demosky S.J.
      • Stonik J.A.
      • Cooney A.M.
      • Comly M.
      • Dwyer N.K.
      • Zhang M.
      • Blanchette-Mackie J.
      • Santamarina-Fojo S.
      • et al.
      Cellular localization and trafficking of the human ABCA1 transporter.
      ). Phillips and colleagues (
      • Vedhachalam C.
      • Duong P.T.
      • Nickel M.
      • Nguyen D.
      • Dhanasekaran P.
      • Saito H.
      • Rothblat G.H.
      • Lund-Katz S.
      • Phillips M.C.
      Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.
      ,
      • Phillips M.C.
      Molecular mechanisms of cellular cholesterol efflux.
      ) propose that ABCA1 is a membrane lipid translocase that facilitates phospholipid and free cholesterol efflux to apoA-1 for HDL biogenesis. Lipid raft is a membrane domain enriched with cholesterol, glycosphingolipid, and signaling proteins, such as caveolin, a characteristic protein of caveolae that are considered a subset of the lipid raft (
      • Pike L.J.
      Lipid rafts: bringing order to chaos.
      ,
      • Pike L.J.
      The challenge of lipid rafts.
      ). Caveolin-1 modulates internalization and degradation of ABCA1, resulting in reduced cholesterol efflux (
      • Lu R.
      • Tsuboi T.
      • Okumura-Noji K.
      • Iwamoto N.
      • Yokoyama S.
      Caveolin-1 facilitates internalization and degradation of ABCA1 and probucol oxidative products interfere with this reaction to increase HDL biogenesis.
      ,
      • Le Lay S.
      • Rodriguez M.
      • Jessup W.
      • Rentero C.
      • Li Q.
      • Cartland S.
      • Grewal T.
      • Gaus K.
      Caveolin-1-mediated apolipoprotein A-I membrane binding sites are not required for cholesterol efflux.
      ). Caveolin-1 knockout leads to higher levels of apoA-1-mediated cholesterol efflux in mouse embryonic fibroblasts (
      • Pike L.J.
      Lipid rafts: bringing order to chaos.
      ,
      • Pike L.J.
      The challenge of lipid rafts.
      ). In this context, it is worth determining whether AC1/cAMP signaling could also affect the lipid raft and/or caveolin-1 expression to modulate apoA-1-mediated cholesterol efflux in macrophage foam cells.
      In addition to adenylyl cyclase/cAMP/PKA signaling, the HDL apolipoprotein-mediated cholesterol efflux pathway is known to involve many other signal proteins and kinases, as mentioned in the introduction. How does AC1/cAMP signaling affect other signaling proteins and kinases? Because both PKA and Epac are immediate downstream effectors of cAMP, we must determine whether agonists for PKA or Epac can replace apoA-1 in the promotion of cholesterol efflux from macrophage foam cells. Then we would know whether cAMP signaling transmits to a next step through PKA or Epac. This approach is similar to the previous studies using c-Jun N-terminal kinase activators anisomycin and hydrogen peroxide to substitute for apoA-1, to partly promote cholesterol efflux from cells (
      • Nofer J.R.
      • Feuerborn R.
      • Levkau B.
      • Sokoll A.
      • Seedorf U.
      • Assmann G.
      Involvement of Cdc42 signaling in apoA-I-induced cholesterol efflux.
      ). We will investigate the next target using a similar strategy to this study, and so on, until the entire signaling pathway is outlined.
      In summary, this study identified AC1 as the major enzyme for apoA-1-activated cAMP production in macrophage foam cells. The second messenger cAMP, generated by AC1, may activate its downstream effectors and promote the vesicle transport of cholesterol for exocytosis to the cell surface, forming cholesterol complexes that are then released to media as nascent HDL particles (
      • Lin G.
      Insights of high-density lipoprotein apolipoprotein-mediated lipid efflux from cells.
      ). This pathway would provide an effective mechanism to remove excess cellular lipids that are otherwise accumulated within the macrophages, and thus reduce the risk of cardiovascular diseases.

      REFERENCES

        • Gordon T.
        • Castelli W.P.
        • Hjortland M.C.
        • Kannel W.B.
        • Dawber T.R.
        High density lipoprotein as a protective factor against coronary heart disease. The Framingham Study.
        Am. J. Med. 1977; 62: 707-714
        • Gordon D.J.
        • Probstfield J.L.
        • Garrison R.J.
        • Neaton J.D.
        • Castelli W.P.
        • Knoke J.D.
        • Jacobs Jr., D.R.
        • Bangdiwala S.
        • Tyroler H.A.
        High-density lipoprotein cholesterol and cardiovascular disease. Four prospective American studies.
        Circulation. 1989; 79: 8-15
        • Nofer J.R.
        Signal transduction by HDL: agonists, receptors, and signaling cascades.
        Handb. Exp. Pharmacol. 2015; 224: 229-256
        • Fidge N.H.
        High density lipoprotein receptors, binding proteins, and ligands.
        J. Lipid Res. 1999; 40: 187-201
        • Mineo C.
        • Shaul P.W.
        Regulation of signal transduction by HDL.
        J. Lipid Res. 2013; 54: 2315-2324
        • Ma W.
        • Lin M.
        • Ding H.
        • Lin G.
        • Zhang Z.
        Beta-COP as a component of transport vesicles for HDL apolipoprotein-mediated cholesterol exocytosis.
        PLoS One. 2016; 11: e0151767
        • Mendez A.J.
        • Uint L.
        Apolipoprotein-mediated cellular cholesterol and phospholipid efflux depend on a functional Golgi apparatus.
        J. Lipid Res. 1996; 37: 2510-2524
        • Lin G.
        • Oram J.F.
        Apolipoprotein binding to protruding membrane domains during removal of excess cellular cholesterol.
        Atherosclerosis. 2000; 149: 359-370
        • Haidar B.
        • Denis M.
        • Krimbou L.
        • Marcil M.
        • Genest Jr, J.
        cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts.
        J. Lipid Res. 2002; 43: 2087-2094
        • Haidar B.
        • Denis M.
        • Marcil M.
        • Krimbou L.
        • Genest Jr, J.
        Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter.
        J. Biol. Chem. 2004; 279: 9963-9969
        • Nofer J.R.
        • Feuerborn R.
        • Levkau B.
        • Sokoll A.
        • Seedorf U.
        • Assmann G.
        Involvement of Cdc42 signaling in apoA-I-induced cholesterol efflux.
        J. Biol. Chem. 2003; 278: 53055-53062
        • Kimura T.
        • Sato K.
        • Malchinkhuu E.
        • Tomura H.
        • Tamama K.
        • Kuwabara A.
        • Murakami M.
        • Okajima F.
        High-density lipoprotein stimulates endothelial cell migration and survival through sphingosine 1-phosphate and its receptors.
        Arterioscler. Thromb. Vasc. Biol. 2003; 23: 1283-1288
        • Utech M.
        • Hobbel G.
        • Rust S.
        • Reinecke H.
        • Assmann G.
        • Walter M.
        Accumulation of RhoA, RhoB, RhoG, and Rac1 in fibroblasts from Tangier disease subjects suggests a regulatory role of Rho family proteins in cholesterol efflux.
        Biochem. Biophys. Res. Commun. 2001; 280: 229-236
        • Tang C.
        • Vaughan A.M.
        • Oram J.F.
        Janus kinase 2 modulates the apolipoprotein interactions with ABCA1 required for removing cellular cholesterol.
        J. Biol. Chem. 2004; 279: 7622-7628
        • Mendez A.J.
        • Oram J.F.
        • Bierman E.L.
        Protein kinase C as a mediator of high density lipoprotein receptor-dependent efflux of intracellular cholesterol.
        J. Biol. Chem. 1991; 266: 10104-10111
        • Walter M.
        • Reinecke H.
        • Gerdes U.
        • Nofer J.R.
        • Hobbel G.
        • Seedorf U.
        • Assmann G.
        Defective regulation of phosphatidylcholine-specific phospholipases C and D in a kindred with Tangier disease. Evidence for the involvement of phosphatidylcholine breakdown in HDL-mediated cholesterol efflux mechanisms.
        J. Clin. Invest. 1996; 98: 2315-2323
        • Takahashi Y.
        • Smith J.D.
        Cholesterol efflux to apolipoprotein AI involves endocytosis and resecretion in a calcium-dependent pathway.
        Proc. Natl. Acad. Sci. USA. 1999; 96: 11358-11363
        • Lin G.
        Insights of high-density lipoprotein apolipoprotein-mediated lipid efflux from cells.
        Biochem. Biophys. Res. Commun. 2002; 291: 727-731
        • Sadana R.
        • Dessauer C.W.
        Physiological roles for G protein-regulated adenylyl cyclase isoforms: insights from knockout and overexpression studies.
        Neurosignals. 2009; 17: 5-22
        • Hokland B.M.
        • Slotte J.P.
        • Bierman E.L.
        • Oram J.F.
        Cyclic AMP stimulates efflux of intracellular sterol from cholesterol-loaded cells.
        J. Biol. Chem. 1993; 268: 25343-25349
        • Risøe P.K.
        • Wang Y.
        • Stuestol J.F.
        • Aasen A.O.
        • Wang J.E.
        • Dahle M.K.
        Lipopolysaccharide attenuates mRNA levels of several adenylyl cyclase isoforms in vivo.
        Biochim. Biophys. Acta. 2007; 1772: 32-39
        • Nakano S.J.
        • Sucharov J.
        • van Dusen R.
        • Cecil M.
        • Nunley K.
        • Wickers S.
        • Karimpur-Fard A.
        • Stauffer B.L.
        • Miyamoto S.D.
        • Sucharov C.C.
        Cardiac adenylyl cyclase and phosphodiesterase expression profiles vary by age, disease, and chronic phosphodiesterase inhibitor treatment.
        J. Card. Fail. 2017; 23: 72-80
        • McCloy R.A.
        • Rogers S.
        • Caldon C.E.
        • Lorca T.
        • Castro A.
        • Burgess A.
        Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events.
        Cell Cycle. 2014; 13: 1400-1412
        • Burgess A.
        • Vigneron S.
        • Brioudes E.
        • Labbe J.C.
        • Lorca T.
        • Castro A.
        Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance.
        Proc. Natl. Acad. Sci. USA. 2010; 107: 12564-12569
        • Vedhachalam C.
        • Duong P.T.
        • Nickel M.
        • Nguyen D.
        • Dhanasekaran P.
        • Saito H.
        • Rothblat G.H.
        • Lund-Katz S.
        • Phillips M.C.
        Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.
        J. Biol. Chem. 2007; 282: 25123-25130
        • Castanho M.A.
        • Coutinho A.
        • Prieto M.J.
        Absorption and fluorescence spectra of polyene antibiotics in the presence of cholesterol.
        J. Biol. Chem. 1992; 267: 204-209
        • Robenek H.
        • Robenek M.J.
        • Troyer D.
        PAT family proteins pervade lipid droplet cores.
        J. Lipid Res. 2005; 46: 1331-1338
        • Heid H.W.
        • Moll R.
        • Schwetlick I.
        • Rackwitz H.R.
        • Keenan T.W.
        Adipophilin is a specific marker of lipid accumulation in diverse cell types and diseases.
        Cell Tissue Res. 1998; 294: 309-321
        • Larigauderie G.
        • Furman C.
        • Jaye M.
        • Lasselin C.
        • Copin C.
        • Fruchart J.C.
        • Castro G.
        • Rouis M.
        Adipophilin enhances lipid accumulation and prevents lipid efflux from THP-1 macrophages: potential role in atherogenesis.
        Arterioscler. Thromb. Vasc. Biol. 2004; 24: 504-510
        • Oram J.F.
        HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol.
        Arterioscler. Thromb. Vasc. Biol. 2003; 23: 720-727
        • Lin S.
        • Zhou C.
        • Neufeld E.
        • Wang Y.H.
        • Xu S.W.
        • Lu L.
        • Wang Y.
        • Liu Z.P.
        • Li D.
        • Li C.
        • et al.
        BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein modulates ATP-binding cassette transporter A-1 trafficking and function.
        Arterioscler. Thromb. Vasc. Biol. 2013; 33: e31-e38
        • Beavo J.A.
        • Brunton L.L.
        Cyclic nucleotide research–still expanding after half a century.
        Nat. Rev. Mol. Cell Biol. 2002; 3: 710-718
        • Hayes J.S.
        • Brunton L.L.
        Functional compartments in cyclic nucleotide action.
        J. Cyclic Nucleotide Res. 1982; 8: 1-16
        • Conti M.
        • Mika D.
        • Richter W.
        Cyclic AMP compartments and signaling specificity: role of cyclic nucleotide phosphodiesterases.
        J. Gen. Physiol. 2014; 143: 29-38
        • Lin G.
        • Bornfeldt K.E.
        Cyclic AMP-specific phosphodiesterase 4 inhibitors promote ABCA1 expression and cholesterol efflux.
        Biochem. Biophys. Res. Commun. 2002; 290: 663-669
        • Smith J.D.
        • Miyata M.
        • Ginsberg M.
        • Grigaux C.
        • Shmookler E.
        • Plump A.S.
        Cyclic AMP induces apolipoprotein E binding activity and promotes cholesterol efflux from a macrophage cell line to apolipoprotein acceptors.
        J. Biol. Chem. 1996; 271: 30647-30655
        • Oram J.F.
        • Lawn R.M.
        • Garvin M.R.
        • Wade D.P.
        ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages.
        J. Biol. Chem. 2000; 275: 34508-34511
        • Le Goff W.
        • Zheng P.
        • Brubaker G.
        • Smith J.D.
        Identification of the cAMP-responsive enhancer of the murine ABCA1 gene: requirement for CREB1 and STAT3/4 elements.
        Arterioscler. Thromb. Vasc. Biol. 2006; 26: 527-533
        • Santamarina-Fojo S.
        • Peterson K.
        • Knapper C.
        • Qiu Y.
        • Freeman L.
        • Cheng J.F.
        • Osorio J.
        • Remaley A.
        • Yang X.P.
        • Haudenschild C.
        • et al.
        Complete genomic sequence of the human ABCA1 gene: analysis of the human and mouse ATP-binding cassette A promoter.
        Proc. Natl. Acad. Sci. USA. 2000; 97: 7987-7992
        • Nagata K.O.
        • Nakada C.
        • Kasai R.S.
        • Kusumi A.
        • Ueda K.
        ABCA1 dimer-monomer interconversion during HDL generation revealed by single-molecule imaging.
        Proc. Natl. Acad. Sci. USA. 2013; 110: 5034-5039
        • Neufeld E.B.
        • Remaley A.T.
        • Demosky S.J.
        • Stonik J.A.
        • Cooney A.M.
        • Comly M.
        • Dwyer N.K.
        • Zhang M.
        • Blanchette-Mackie J.
        • Santamarina-Fojo S.
        • et al.
        Cellular localization and trafficking of the human ABCA1 transporter.
        J. Biol. Chem. 2001; 276: 27584-27590
        • Phillips M.C.
        Molecular mechanisms of cellular cholesterol efflux.
        J. Biol. Chem. 2014; 289: 24020-24029
        • Pike L.J.
        Lipid rafts: bringing order to chaos.
        J. Lipid Res. 2003; 44: 655-667
        • Pike L.J.
        The challenge of lipid rafts.
        J. Lipid Res. 2009; 50: S323-S328
        • Lu R.
        • Tsuboi T.
        • Okumura-Noji K.
        • Iwamoto N.
        • Yokoyama S.
        Caveolin-1 facilitates internalization and degradation of ABCA1 and probucol oxidative products interfere with this reaction to increase HDL biogenesis.
        Atherosclerosis. 2016; 253: 54-60
        • Le Lay S.
        • Rodriguez M.
        • Jessup W.
        • Rentero C.
        • Li Q.
        • Cartland S.
        • Grewal T.
        • Gaus K.
        Caveolin-1-mediated apolipoprotein A-I membrane binding sites are not required for cholesterol efflux.
        PLoS One. 2011; 6: e23353