Advertisement
Research Articles| Volume 54, ISSUE 12, P3258-3268, December 2013

DHA attenuates postprandial hyperlipidemia via activating PPARα in intestinal epithelial cells[S]

  • Rino Kimura
    Affiliations
    Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan
    Search for articles by this author
  • Nobuyuki Takahashi
    Correspondence
    To whom correspondence should be addressed
    Affiliations
    Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan

    Research Unit for Physiological Chemistry, Center for the Promotion of Interdisciplinary Education and Research, Kyoto University, Kyoto, Japan
    Search for articles by this author
  • Shan Lin
    Affiliations
    Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan
    Search for articles by this author
  • Tsuyoshi Goto
    Affiliations
    Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan

    Research Unit for Physiological Chemistry, Center for the Promotion of Interdisciplinary Education and Research, Kyoto University, Kyoto, Japan
    Search for articles by this author
  • Kaeko Murota
    Affiliations
    Department of Life Science, School of Science and Engineering, Kinki University, Osaka, Japan
    Search for articles by this author
  • Rieko Nakata
    Affiliations
    Department of Food Science and Nutrition, Nara Women's University, Nara, Japan
    Search for articles by this author
  • Hiroyasu Inoue
    Affiliations
    Department of Food Science and Nutrition, Nara Women's University, Nara, Japan
    Search for articles by this author
  • Teruo Kawada
    Affiliations
    Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan

    Research Unit for Physiological Chemistry, Center for the Promotion of Interdisciplinary Education and Research, Kyoto University, Kyoto, Japan
    Search for articles by this author
  • Author Footnotes
    [S] The online version of this article (available at http://www.jlr.org) contains supplementary data in the form of four figures and one table.
Open AccessPublished:October 16, 2013DOI:https://doi.org/10.1194/jlr.M034942
      It is known that peroxisome proliferator-activated receptor (PPAR)α, whose activation reduces hyperlipidemia, is highly expressed in intestinal epithelial cells. Docosahexaenoic acid (DHA) could improve postprandial hyperlipidemia, however, its relationship with intestinal PPARα activation is not revealed. In this study, we investigated whether DHA can affect postprandial hyperlipidemia by activating intestinal PPARα using Caco-2 cells and C57BL/6 mice. The genes involved in fatty acid (FA) oxidation and oxygen consumption rate were increased, and the secretion of triacylglyceride (TG) and apolipoprotein B (apoB) was decreased in DHA-treated Caco-2 cells. Additionally, intestinal FA oxidation was induced, and TG and apoB secretion from intestinal epithelial cells was reduced, resulting in the attenuation of plasma TG and apoB levels after oral administration of olive oil in DHA-rich oil-fed mice compared with controls. However, no increase in genes involved in FA oxidation was observed in the liver. Furthermore, the effects of DHA on intestinal lipid secretion and postprandial hyperlipidemia were abolished in PPARα knockout mice. In conclusion, the present work suggests that DHA can inhibit the secretion of TG from intestinal epithelial cells via PPARα activation, which attenuates postprandial hyperlipidemia.
      Over the past few decades, the prevalence of metabolic syndrome has markedly increased worldwide, particularly in wealthy industrialized countries (
      • Ogden C.L.
      • Yanovski S.Z.
      • Carroll M.D.
      • Flegal K.M.
      The epidemiology of obesity.
      ). Metabolic syndrome includes multiple factors such as insulin resistance, dyslipidemia, and central obesity and increases the risk of developing serious metabolic disorders such as cardiovascular diseases and type 2 diabetes. Many epidemiological studies, including prospective cohort studies (
      • Bansal S.
      • Buring J.E.
      • Rifai N.
      • Mora S.
      • Sacks F.M.
      • Ridker P.M.
      Fasting compared with nonfasting triglycerides and risk of cardiovascular events in women.
      ,
      • Freiberg J.J.
      • Tybjaerg-Hansen A.
      • Jensen J.S.
      • Nordestgaard B.G.
      Nonfasting triglycerides and risk of ischemic stroke in the general population.
      ,
      • Iso H.
      • Naito Y.
      • Sato S.
      • Kitamura A.
      • Okamura T.
      • Sankai T.
      • Shimamoto T.
      • Iida M.
      • Komachi Y.
      Serum triglycerides and risk of coronary heart disease among Japanese men and women.
      ), cross-sectional studies (
      • Boquist S.
      • Ruotolo G.
      • Tang R.
      • Björkegren J.
      • Bond M.G.
      • de Faire U.
      • Karpe F.
      • Hamsten A.
      Alimentary lipemia, postprandial triglyceride-rich lipoproteins, and common carotid intima-media thickness in healthy, middle-aged men.
      ,
      • Patsch J.R.
      • Miesenböck G.
      • Hopferwieser T.
      • Mühlberger V.
      • Knapp E.
      • Dunn J.K.
      • Gotto Jr, A.M.
      • Patsch W.
      Relation of triglyceride metabolism and coronary artery disease. Studies in the postprandial state.
      ), and case-control studies (
      • Björkegren J.
      • Boquist S.
      • Samnegârd A.
      • Lundman P.
      • Tornvall P.
      • Ericsson C.G.
      • Hamsten A.
      Accumulation of apolipoprotein C–I-rich and cholesterol-rich VLDL remnants during exaggerated postprandial triglyceridemia in normolipidemic patients with coronary artery disease.
      ), demonstrate that postprandial hyperlipidemia is an independent risk factor for cardiovascular disease. Therefore, attenuating postprandial hyperlipidemia could be a key factor for preventing cardiovascular diseases.
      High intake of dietary fat significantly increases postprandial plasma triacylglyceride (TG) levels. The epithelial cells in the small intestine are constantly exposed to this dietary fat. Therefore, the regulation of lipid metabolism in intestinal epithelial cells could affect postprandial hyperlipidemia. Previous studies have demonstrated that peroxisome proliferator-activated receptor (PPAR)α is highly expressed in intestinal epithelial cells along the length of the small intestine as well as in the liver, skeletal muscle, and brown fat (
      • Bünger M.
      • Van Den Bosch H.M.
      • Van Der Meijde J.
      • Kersten S.
      • Hooiveld G.
      • Müller M.
      Genome-wide analysis of PPARalpha activation in murine small intestine.
      ,
      • Kersten S.
      • Desvergne B.
      • Wahli W.
      Roles of PPARs in health and disease.
      ). PPARα, which is a nuclear transcriptional factor, regulates the mRNA expression of fatty acid (FA) oxidation-related enzymes (
      • Hashimoto T.
      • Cook W.
      • Qi C.
      • Yeldandi A.
      • Reddy J.
      • Rao M.
      Defect in peroxisome proliferator-activated receptor alpha inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting.
      ,
      • Minnich A.
      • Tian N.
      • Byan L.
      • Bilder G.
      A potent PPAR agonist stimulates mitochondrial fatty acid-oxidation in liver and skeletal muscle.
      ). Synthetic PPARα agonists, such as fibrates, decrease circulating lipid levels and are commonly used as drugs for the treatment of hyperlipidemia (
      • Schoonjans K.
      • Staels B.
      • Auwerx J.
      Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression.
      ). PPARα knockout (PPARα−/−) mice showed dyslipidemia (
      • Akiyama T.E.
      • Nicol C.J.
      • Fievet C.
      • Staels B.
      • Ward J.M.
      • Auwerx J.
      • Lee S.S.
      • Gonzalez F.J.
      • Peters J.M.
      Peroxisome proliferator-activated receptor-alpha regulates lipid homeostasis, but is not associated with obesity: studies with congenic mouse lines.
      ,
      • Lindén D.
      • Alsterholm M.
      • Wennbo H.
      • Oscarsson J.
      PPARalpha deficiency increases secretion and serum levels of apolipoprotein B-containing lipoproteins.
      ). Recently, we and others have reported that activation of PPARα in intestinal epithelial cells improves postprandial hyperlipidemia through enhancing FA oxidation (
      • Kimura R.
      • Takahashi N.
      • Murota K.
      • Yamada Y.
      • Niiya S.
      • Kanzaki N.
      • Murakami Y.
      • Moriyama T.
      • Goto T.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-α (PPARα) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes.
      ,
      • Uchida A.
      • Slipchenko M.N.
      • Cheng J.X.
      • Buhman K.K.
      Fenofibrate, a peroxisome proliferator-activated receptor α agonist, alters triglyceride metabolism in enterocytes of mice.
      ). PUFAs, such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), are known to lower plasma TG; the mechanism responsible for their hypolipidemic action is thought to be involved in the regulation of TG clearance from circulation and TG synthesis in the liver (
      • Wong S.H.
      • Fisher E.A.
      • Marsh J.B.
      Effects of eicosapentaenoic and docosahexaenoic acids on apoprotein B mRNA and secretion of very low density lipoprotein in HepG2 cells.
      ,
      • Nestel P.J.
      • Connor W.E.
      • Reardon M.F.
      • Connor S.
      • Wong S.
      • Boston R.
      Suppression by diets rich in fish oil of very low density lipoprotein production in man.
      ,
      • Park Y.
      • Harris W.S.
      Omega-3 fatty acid supplementation accelerates chylomicron triglyceride clearance.
      ). Recent studies have found that PUFAs increase the mRNA expression levels of genes involved in FA oxidation in intestinal epithelial cells (
      • van Schothorst E.M.
      • Flachs P.
      • Franssen-van Hal N.L.
      • Kuda O.
      • Bunschoten A.
      • Molthoff J.
      • Vink C.
      • Hooiveld G.J.
      • Kopecky J.
      • Keijer J.
      Induction of lipid oxidation by polyunsaturated fatty acids of marine origin in small intestine of mice fed a high-fat diet.
      ). However, it is unknown whether dietary lipids, such as DHA could affect the intestinal lipid metabolism, resulting in improvement of postprandial hyperlipidemia.
      In this study, we investigated whether DHA improves postprandial hyperlipidemia by altering the lipid metabolism in intestinal epithelial cells. DHA induced FA oxidation in intestinal epithelial cells by activating PPARα, which attenuated postprandial hyperlipidemia by directly reducing TG secretion from intestinal epithelial cells. Furthermore, we confirmed that hepatic lipid metabolism is unlikely to contribute to these effects of DHA. These findings suggest that activating intestinal PPARα by dietary lipids such as DHA may shed light on postprandial hyperlipidemia-induced cardiovascular diseases.

      MATERIALS AND METHODS

      Chemicals and cell culture

      DHA and EPA were purchased from Nacalai Tesque (Kyoto, Japan) and dissolved in ethanol. Bezafibrate was purchased from Sigma (St. Louis, MO) and dissolved in dimethylsulfoxide (DMSO) as a stock solution. Decanoic acid and palmitic acid were purchased from Nacalai Tesque and Wako Pure Chemicals (Osaka, Japan), respectively. All other chemicals used were from Sigma or Nacalai Tesque and were guaranteed to be reagent or tissue-culture grade.
      Human Caco-2 cells were purchased from American Type Culture Collection (ATCC, Manassas, VA) and were cultured in DMEM (100 mg/dl glucose) containing 10% fetal bovine serum, 1% nonessential amino acid solution, and 10 mg/ml penicillin/streptomycin at 37°C in 5% CO2/95% air under humidified conditions. Caco-2 cells were seeded at a density of 1.2 × 106 cells/ml on 12-well Transwell plates (Corning Inc., Corning, NY) for 2 weeks for differentiation into intestinal epithelial-like cells. To evaluate differentiation of Caco-2 cells, we measured transepithelial electrical resistance. No significance in transepithelial electrical resistance was detected in any experiment (data not shown). The apical medium was changed to DMEM containing either 1 μM or 25 μM DHA or 50 μM bezafibrate and 600 μM taurocholic acid Na salt hydrate and 500 μM oleic acid. Additionally, the basolateral medium was changed to serum-free DMEM. After 48 h, the basolateral medium was collected to measure TG and apolipoprotein B (apoB) secretion. Cell viability was measured in Caco-2 cells treated with DHA and bezafibrate based on cell titers (Promega, Fitchburg, WI).

      Luciferase assays

      Luciferase assays were performed using the modified dual luciferase system as previously described (
      • Goto T.
      • Takahashi N.
      • Kato S.
      • Egawa K.
      • Ebisu S.
      • Moriyama T.
      • Fushiki T.
      • Kawada T.
      Phytol directly activates peroxisome proliferator-activated receptor alpha (PPAR alpha) and regulates gene expression involved in lipid metabolism in PPAR alpha-expressing HepG2 hepatocytes.
      ). Briefly, for luciferase assays using the GAL4/PPAR chimera system, CV-1 cells or Caco-2 cells were transfected with p4xUASg-tk-luc (reporter plasmid), pM-h PPARα (chimeric plasmid expressing GAL4 DNA binding domain and human PPARα-ligand binding domain), pM-h PPARγ or pM-h PPARδ, and pRL-CMV (internal control plasmid for normalizing transfection efficiencies). Transfected cells were treated with DHA and EPA at the indicated concentrations for 24 h. Bezafibrate (50 μM), pioglitazone (1 μM), or GW501516 (1 μM) were used as positive controls. For luciferase assays using a PPAR full-length system, a reporter plasmid (p4xPPRE-tk-luc) and pRL-CMV were transfected into Caco-2 cells. Transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Four hours after transfection, transfected cells were cultured in medium containing DHA for an additional 24 h. Luciferase assays were performed using the dual luciferase system according to the manufacturer's protocol.

      Real-time quantitative RT-PCR

      Total RNA samples were prepared from Caco-2 cells, mouse intestinal epithelial cells, and hepatocytes using Sepasol Super-I (Nacalai Tesque) and Qiazol lysis reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions, respectively. Using M-MLV reverse transcriptase (Invitrogen), total RNA was reverse-transcribed following the manufacturer's protocol using a thermal cycler (Takara, Shiga, Japan). To quantify mRNA expression, real-time PCR was performed using a LightCycler system (Roche Diagnostics, Mannheim, Germany) using SYBR Green fluorescence signals as described previously (
      • Kuroyanagi K.
      • Kang M.S.
      • Goto T.
      • Hirai S.
      • Ohyama K.
      • Kusudo T.
      • Yu R.
      • Yano M.
      • Sasaki T.
      • Takahashi N.
      • et al.
      Citrus auraptene acts as an agonist for PPARs and enhances adiponectin production and MCP-1 reduction in 3T3–L1 adipocytes.
      ). Oligonucleotide primers of human and mouse 36B4 and PPARα target genes used in this study were designed using a PCR primer selection program found in the website of the Virtual Genomic Center from the GenBank database, as previously described (Table 1) (
      • Takahashi N.
      • Senda M.
      • Lin S.
      • Goto T.
      • Yano M.
      • Sasaki T.
      • Murakami S.
      • Kawada T.
      Auraptene regulates gene expression involved in lipid metabolism through PPARα activation in diabetic obese mice.
      ). To compare mRNA expression levels among samples, copy numbers of all transcripts were divided by that of human and mouse 36B4, showing a constant expression level. All mRNA expression levels are represented relative to the control in each experiment.
      TABLE 1Primers used for quantitative real-time PCR
      GenePrimer sequences (5′–3′)
      Human 36b4Fw: AAACTGCTGCCTCATATCCGG
      Rev: TTGTAGATGCTGCCATTGTCGA
      Human AcsFw: AGCAGAGCTTCGCAGCGGC
      Rev: CTGCTGTTTTCGCTGGGTCC
      Human Cpt1aFw: AATCATCAAGAAATGTCGCACGA
      Rev: AGGCAGAAGAGGTGACGATCG
      Human AoxFw: GGCATGGTGTCCTATTTGAACG
      Rev: AAGCAACAGCATCTGAGCGAAT
      Human Ucp2Fw: CAAATGAGCTTTGCCTCTGTC
      Rev: ATGGTCTTGTAGGCATTGACG
      Human FabpFw: CCTTCATGAAGGCAATCGGTC
      Rev: AATGTCATGGTATTGGTGATTATGTCG
      Mouse 36b4Fw: TGTGTGTCTGCAGATCGGGTAC
      Rev: CTTTGGCGGGATTAGTCGAAG
      Mouse AcsFw: ACGTATCCCTGGACTAGGACCG
      Rev: GAGATATTCTGGCCACCGATCA
      Mouse Cpt1aFw: CTCAGTGGGAGCGACTCTTCA
      Rev: GGCCTCTGTGGTACACGACAA
      Mouse AoxFw: CTTGTTCGCGCAAGTGAGG
      Rev: CAGGATCCGACTGTTTACC
      mouse Ucp2Fw: CCCAGCCTACAGATGTGGTAA
      Rev: GAGGTTGGCTTTCAGGAGAGT
      Mouse FabpFw: AAGACAGCTCCTCCTCGAAGGTT
      Rev: TGACCAAATCCCCTAAATGCG
      Mouse Cd36Fw: ATTGTACCTGGGAGTTGGCGAGAA
      Rev: AACTGTCTGTAGACAGTGGTGCCT
      Fw, forward; Rev, reverse.

      Measurement of oxygen consumption rate in Caco-2 cells

      The cellular oxygen consumption rate (OCR) was measured using a Seahorse Bioscience XF analyzer in 24-well plates at 37°C, with correction for positional temperature variations adjusted for the four empty wells in the plate (
      • Wu M.
      • Neilson A.
      • Swift A.L.
      • Moran R.
      • Tamagnine J.
      • Parslow D.
      • Armistead S.
      • Lemire K.
      • Orrell J.
      • Teich J.
      • et al.
      Multiparameter metabolic analysis reveals a close link between attenuated mitochondrial bioenergetic function and enhanced glycolysis dependency in human tumor cells.
      ,
      • Goto T.
      • Lee J.Y.
      • Teraminami A.
      • Kim Y.I.
      • Hirai S.
      • Uemura T.
      • Inoue H.
      • Takahashi N.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-alpha stimulates both differentiation and fatty acid oxidation in adipocytes.
      ). Caco-2 cells were cultured for 2 weeks after seeding on the plate and were treated with PPARα agonist, 50 μM bezafibrate, or either 1 μM or 25 μM DHA. Immediately before the measurement, cells were washed, and 675 μl of nonbuffered (sodium-carbonate-free, pH 7.4) DMEM medium supplemented with 0.2 mM palmitic acid, 0.2 mM l-carnitine, and 2% FA-free BSA was added to each well. After equilibration for 30 min, 2 min measurements were performed at 3 min intervals with inter-measurement mixing to homogenize the oxygen in the medium.

      Measurement of TG and apoB secretion in Caco-2 cells

      To measure TG secretion, we used the Triglyceride E Test Wako kit (Wako Pure Chemicals). To measure apoB secretion, an enzyme-linked immunosorbent assay (ELISA) was performed using an anti-human low density lipoprotein apoB antibody (Clone 12G10; Monosan, Uden, The Netherlands), affinity-purified anti-apoB (Rockland, Gilbertsville, PA), and horseradish peroxidase (HRP)-conjugated anti-goat IgG (Promega) as the capture, primary, and secondary antibodies, respectively. Details of these procedures have been previously described (
      • Kimura R.
      • Takahashi N.
      • Murota K.
      • Yamada Y.
      • Niiya S.
      • Kanzaki N.
      • Murakami Y.
      • Moriyama T.
      • Goto T.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-α (PPARα) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes.
      ). HRP activity was detected using a 3,3′,5,5′-tetramethylbenzidine peroxidase substrate (KPL, Gaithersburg, MD).

      Animal experiments

      DHA-rich oil containing 25.4% DHA and 8% EPA was a gift from NOF Corporation (Kanagawa, Japan). EPA-rich oil containing 28.4% EPA and 12.3% DHA was a gift from Nippon Suisan Kaisha, Ltd. (Tokyo, Japan). All other chemicals were from Sigma or Nacalai Tesque and were guaranteed to be reagent or tissue-culture grade.
      All mice were maintained separately in a temperature-controlled (23°C) facility under a constant 12 h light/dark cycle with free access to water. To analyze the effects of DHA on intestinal lipid metabolism and postprandial hyperlipidemia, 9-week-old male C57BL/6 mice (CLEA Japan, Tokyo, Japan) were fed a high-fat diet (HFD) consisting of 60% (kcal%) fat from dietary oil, 26% protein, and 14% carbohydrate for 1 week to induce postprandial hyperlipidemia (
      • Hernández Vallejo S.J.
      • Alqub M.
      • Luquet S.
      • Cruciani-Guglielmacci C.
      • Delerive P.
      • Lobaccaro J.M.
      • Kalopissis A.D.
      • Chambaz J.
      • Rousset M.
      • Lacorte J.M.
      Short-term adaptation of postprandial lipoprotein secretion and intestinal gene expression to a high-fat diet.
      ), and were then divided into three groups with the same average serum TG level and body weight after 16 h fasting. Ten-week-old male C57BL/6 mice were maintained for 1 week either on a 60% HFD or on a diet containing 1.9% DHA or 3.7% DHA, maintaining the total amount of fat at 60%. The detailed composition of the experimental diets is described in Table 2 (
      • Nakatani T.
      • Kim H.J.
      • Kaburagi Y.
      • Yasuda K.
      • Ezaki O.
      A low fish oil inhibits SREBP-1 proteolytic cascade, while a high-fish-oil feeding decreases SREBP-1 mRNA in mice liver: relationship to anti-obesity.
      ). As shown in supplementary Fig. III, EPA-rich oil containing 28.4% EPA and 12.3% DHA was diluted with corn oil to prepare a HFD with final concentrations of 3.4% EPA and 1.5% DHA, maintaining the total amount of fat at 60%. The energy intake of all mice was adjusted by pair feeding, and food intake was determined daily for seven consecutive days. Anesthesia was induced using sevoflurane in all experiments. The procedures for animal care were approved by the Animal Research Committee of Kyoto University.
      TABLE 2Composition of experimental diets
      Experimental DietControl1.9% DHA3.7% DHA
      DHA-rich oil (%)
      Percent of weight from total food weight.
      04.138.25
      Corn oil (%)33.529.3825.25
      Casein (%)292929
      Sucrose (%)23.2923.2923.29
      Vitamin mix (%)1.451.451.45
      Mineral mix (%)5.085.085.08
      Cellulose powder (%)7.257.257.25
      l-Cysteine (%)0.440.440.44
      Fat energy (en %)
      Percent of energy from total energy intake.
      60.560.660.7
      DHA (en %)
      Percent of energy from total energy intake.
      01.853.69
      EPA (en %)
      Percent of energy from total energy intake.
      00.581.16
      a Percent of weight from total food weight.
      b Percent of energy from total energy intake.
      To clarify whether the effects of DHA-rich oil on intestinal lipid metabolism and postprandial hyperlipidemia involves PPARα, we used PPARα−/− mice with a C57BL/6 genetic background. PPARα−/− mice were fed a HFD consisting of 60% (kcal%) fat for 1 week, and were then divided into two groups with the same average serum TG level and body weight after 16 h fasting. Ten-week-old male PPARα−/− mice were maintained for 1 week either on a 60% HFD or on a 60% HFD containing 3.7% DHA or 0.2% bezafibrate.
      For RNA analysis, the proximal intestine and the liver were harvested from the mice. After washing, intestinal epithelial cells were collected using a slide glass. Collected tissue was stored in RNAlater (Ambion, Austin TX; Applied Biosystems, Foster City, CA) at −80°C until use.

      Measurement of FA oxidation

      FA oxidation with isolated intestinal epithelial cells and hepatocytes was analyzed as previously described (
      • Kimura R.
      • Takahashi N.
      • Murota K.
      • Yamada Y.
      • Niiya S.
      • Kanzaki N.
      • Murakami Y.
      • Moriyama T.
      • Goto T.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-α (PPARα) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes.
      ,
      • Goto T.
      • Lee J.Y.
      • Teraminami A.
      • Kim Y.I.
      • Hirai S.
      • Uemura T.
      • Inoue H.
      • Takahashi N.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-alpha stimulates both differentiation and fatty acid oxidation in adipocytes.
      ). Briefly, collected intestinal epithelial cells and hepatocytes were washed with 1% FBS/DMEM three times and used for experiments. Cells were incubated with a piece of filter paper containing 200 μl 3 N NaOH in DMEM containing 200 μM palmitic acid, 0.1% FA-free BSA, 200 μM l-carnitine, and [14C]palmitic acid (1 μCi/ml) (American Radiolabeled Chemicals, St. Louis, MO) at 37°C for 2 h. The tubes were gently shaken every 30 min during incubation. After 2 h of incubation, 200 μl of 12 N HCl was added to the cells to release [14C]CO2 and they were incubated at 37°C overnight to trap [14C]CO2. The saturated filter paper containing trapped [14C]CO2 was assessed for radioactivity in a liquid scintillation counter (LS6500; Beckman Coulter, Brea, CA). The acidified medium was centrifuged, and 200 μl of supernatant was assessed to determine the amount of [14C]-labeled acid-soluble metabolites (ASMs), which includes ketone bodies. Protein concentration was determined using a protein assay kit (Bio-Rad, Hercules, CA).

      Postprandial TG and apoB secretion

      To measure plasma TG concentration, mice were administrated an oral gavage of 300 μl olive oil after a 16 h fast, and blood samples were collected every 30 min to 240 min after olive oil administration from the tail vein of nonanesthetized mice.
      To measure TG secretion from intestinal epithelial cells, mice were injected with 500 mg/kg body weight tyloxapol (T0307, Sigma) into the intraperitoneal cavity to block serum lipase activity after a 16 h fast (
      • Lin X.
      • Yue P.
      • Chen Z.
      • Schonfeld G.
      Hepatic triglyceride contents are genetically determined in mice: results of a strain survey.
      ). After 30 min, mice were administrated an oral gavage of 300 μl olive oil. Blood samples were obtained before tyloxapol injection and every 30 min for 240 min after olive oil administration. Plasma TG concentration was determined using the Triglyceride E-Test Wako kit (Wako Pure Chemicals).
      To measure postprandial apoB48 secretion, plasma collected at 120 min was mixed with Laemmli sample buffer (Bio-Rad) (1:8) and boiled for 5 min at 95°C. Plasma samples were subjected to SDS-PAGE on a 5% gel. Separated proteins were transferred electrophoretically to polyvinylidene fluoride membranes (Millipore Corporation, Billerica, MA), which were blocked with 5% nonfat dried milk in phosphate-buffered saline. The membranes were incubated with the anti-mouse apoB48/100 antibodies (Meridian Life Science, Memphis, TN), and then with peroxidase-conjugated anti-rabbit IgG antibodies (Santa Cruz Biotechnologies, Santa Cruz, CA), respectively. Protein bands were detected using an enhanced chemiluminescence (ECL) Western blotting detection system (Millipore Corporation). The bands were quantitatively evaluated using National Institutes of Health Image J software.

      Measurement of intestinal TG in mice

      Lipids in intestinal mucosa were extracted using the hexane/isopropanol (3:2) extraction methods (
      • Eder K.
      • Reichlmayr-Lais A.M.
      • Kirchgessner M.
      Studies on the extraction of phospholipids from erythrocyte membranes in the rat.
      ). Briefly, intestinal mucosa were homogenized using hexane/isopropanol (3:2) for 1 min, the suspension was centrifuged, and the pellet was rinsed with the same solvent. The entire liquid phase was evaporated, the dried extract dissolved in isopropanol, and TG content was measured as above. Triolein dissolved in isopropanol was used as the standard for TG. The efficiency of extraction was measured by comparing the recovery of triolein in samples that had been spiked and samples that had not been spiked with known quantities of triolein standard (
      • Perera M.A.
      • Choi S.Y.
      • Wurtele E.S.
      • Nikolau B.J.
      Quantitative analysis of short-chain acyl-coenzyme As in plant tissues by LC-MS-MS electrospray ionization method.
      ). The assessed recovery was 81.2 ± 4.65%.

      Measurement of TG in feces of mice

      The feces were dried at 60°C overnight and the lipids were extracted using the Folch method (
      • Folch J.
      • Lees M.
      • Sloane Stanley G.H.
      A simple method for the isolation and purification of total lipids from animal tissues.
      ). This analysis enables measurement of lipids extracted per gram of dried fecal samples. Briefly, lipids present in the feces were extracted using chloroform/methanol (2:1), dissolved in isopropanol, and TG content was measured as above.

      Statistical analysis

      Data are presented as means ± SEM. For analyses of two groups, unpaired Student's t-test was used. To analyze three or more groups, ANOVA was used along with Tukey-Kramer's multiple comparison tests to determine statistical significance. Differences were considered significant at P < 0.05.

      RESULTS

      DHA activated PPARα in CV-1 cells and Caco-2 cells

      First, we investigated whether DHA activated PPARα based on a luciferase assay using the GAL4/PPARα chimera system. DHA activated luciferase activity of PPARα in CV-1 cells in a dose-dependent manner (Fig. 1A). Furthermore, DHA stimulated PPAR-response element (PPRE)-luciferase activity in Caco-2 cells (Fig. 1B). DHA also activated luciferase activity of PPARα in Caco-2 cells (Fig. 1C). The effects of DHA on PPARα activation were higher than those of EPA under our experimental conditions (approximately 5.9- and 2.6-fold increases at 25 μM DHA and EPA, respectively), as shown in Fig. 1C. Moreover, DHA enhanced the activation of PPARγ by approximately 1.7-fold (Fig. 1D). However, DHA did not increase PPARδ activation in Caco-2 cells (Fig. 1E, supplementary Fig. I). Cytotoxicity was not observed following 25 μM DHA treatment of Caco-2 cells (data not shown). These results suggest that DHA induces PPARα activation in intact cells.
      Figure thumbnail gr1
      Fig. 1DHA activated PPARα in luciferase assays using the GAL4 chimera and PPRE-luc systems. A: Luciferase assay using the GAL4/ PPARα chimera system in CV-1 cells. Reporter plasmids (p4XUASg-luc and pRL-CMV) were transfected into CV-1 cells together with pM-h PPARα. Transfected cells were treated with bezafibrate (Beza) or DHA at the indicated concentrations for 24 h. B: Luciferase assay using a PPRE-luc system in Caco-2 cells. Reporter plasmids (p4XPPRE-tk-luc and pRL-CMV) were transfected into Caco-2 cells. Transfected cells were treated with bezafibrate or DHA at the indicated concentrations for 24 h. C–E: Luciferase assay using the GAL4/ PPARα, PPARγ, and PPARδ chimera system in Caco-2 cells. Reporter plasmids were transfected with pM-hPPARα, pM-hPPARγ, and pM-hPPARδ in Caco-2 cells. Transfected cells were treated with 25 μM DHA and EPA, and 50 μM bezafibrate, 1 μM pioglitazone (pio), or 1 μM GW501516 (GW) as positive controls (Cont) for 24 h. The average activity of luciferase in a vehicle control was set at 100% and the relative activities were represented as fold induction relative to that of control. Values are means ± SEM of 510 tests. *P < 0.05 and **P < 0.01 compared with each control.

      DHA induced the genes involved in FA oxidation and OCR in Caco-2 cells

      To investigate the effects of PPARα activation by DHA on intestinal lipid metabolism, we measured mRNA expression levels of genes involved in FA oxidation in DHA-treated Caco-2 cells. DHA treatment induced mRNA expression of genes involved in FA oxidation, such as acyl-CoA synthetase (Acs), carnitine palmitoyltransferase 1A (Cpt1a), and acyl-CoA oxidase (Aox) and other PPARα target genes such as uncoupling protein-2 (Ucp2) and fatty acid binding protein (Fabp) (Fig. 2A–E). Moreover, the OCR, determined using extracellular flux analysis, was enhanced following DHA treatment as shown in Fig. 2F. In contrast, decanoic acid (C10), which had little activity toward PPARα, did not affect mRNA expression of Cpt1a, and palmitic acid (C16), which showed lower PPARα activity than DHA, did not significantly induce Cpt1a expression in Caco-2 cells (supplementary Fig. IIA, B). These findings suggest that DHA enhances FA oxidation in Caco-2 cells.
      Figure thumbnail gr2
      Fig. 2FA oxidation-related gene expressions and OCR were increased in DHA-treated Caco-2 cells. A–E: The mRNA expression levels of FA oxidation-related genes (Acs, Cpt1a, and Aox) and other PPARα target genes (Ucp2 and Fabp) were quantified. F: The OCR was determined using extracellular flux analysis as described in the Materials and Methods section. Values of controls were set at 100% and the relative values were represented as fold induction relative to that of control. Values are means ± SEM of six tests. Cont, control; Beza, bezafibrate. *P < 0.05 and **P < 0.01 compared with each control.

      DHA decreased the secretion of TG and apoB from Caco-2 cells

      To determine the effects of PPARα activation by DHA on lipid secretion from Caco-2 cells, we examined the amounts of lipid secreted from DHA-treated Caco-2 cells. TG secretion from DHA-treated Caco-2 cells was significantly decreased (to 77 and 72% with either 1 or 25 μM DHA treatment, respectively), as shown in Fig. 3A. DHA treatment reduced the secretion of apoB, which is the primary apolipoprotein of chylomicrons, to 67 and 59% with either 1 or 25 μM DHA treatment, respectively (Fig. 3B). The effects of DHA on secretion were similar to those of bezafibrate, a potent PPARα agonist (Fig. 3A, B). While C10 did not inhibit TG secretion, C16 did decrease TG secretion from Caco-2 cells. However, the effect of C16 on decrease of TG secretion was lower than that of DHA (supplementary Fig. IIC). These results suggest that lipid secretion from intestinal epithelial cells is related to PPARα activity.
      Figure thumbnail gr3
      Fig. 3DHA decreased TG and apoB secretion from Caco-2 cells. TG (A) and apoB (B) secretion from Caco-2 cells into the basolateral side were measured as described in the Materials and Methods section. Control (Cont) values were set at 100% and the relative values were represented as fold induction relative to that of control. Values are means ± SEM of six tests. Beza, bezafibrate. *P < 0.05 and **P < 0.01 compared with each control.

      DHA-rich oil enhanced FA oxidation in intestinal epithelial cells of C57BL/6 mice

      Next, we examined whether the effects of DHA in vitro also occurred in vivo. Because PPARα agonists are known to reduce food intake in rodents (
      • Fu J.
      • Gaetani S.
      • Oveisi F.
      • Lo Verme J.
      • Serrano A.
      • Rodríguez De Fonseca F.
      • Rosengarth A.
      • Luecke H.
      • Di Giacomo B.
      • Tarzia G.
      • et al.
      Oleylethanolamide regulates feeding and body weight through activation of the nuclear receptor PPAR-alpha.
      ), all mice were housed in pair-fed conditions in each experiment; there was no difference in food intake between groups. The mRNA expression levels of FA oxidation-related genes such as Acs, Cpt1a, and Aox and other PPARα target genes such as Ucp2, Fabp, and Cd36 were increased in C57BL/6 mice fed a HFD containing DHA-rich oil for one week (Fig. 4A–F). When the cells were incubated with [14C]palmitic acid for 2 h, oxidation of [14C]palmitic acid to CO2 and ASMs were enhanced in intestinal epithelial cells of DHA-rich oil-fed mice compared with control mice (Fig. 4G, H). However, surprisingly, DHA-rich oil-fed mice showed no increase in mRNA expression levels of FA oxidation-related genes in the liver under the same conditions as shown in Fig. 5A–C. Moreover, the production of CO2 and ASM were not augmented in the liver of DHA-rich oil-fed mice compared with control mice (Fig. 5D, E). These findings suggest that DHA-rich oil enhances FA oxidation in intestinal epithelial cells of mice.
      Figure thumbnail gr4
      Fig. 4FA oxidation was enhanced in intestinal epithelial cells of DHA-rich oil-fed C57BL/6 mice. A–F: The mRNA expression levels of FA oxidation-related genes (Acs, Cpt1a, and Aox) and other PPARα target genes (Ucp2, Fabp, and Cd36) in intestinal epithelial cells were quantified. G, H: Production of CO2 and ASM in intestinal epithelial cells was determined using [14C]palmitic acid. Control values were set at 100% and the relative values are represented as fold induction relative to that of control. The values are means ± SEM of six tests. *P < 0.05 and **P < 0.01 compared with each control.
      Figure thumbnail gr5
      Fig. 5FA oxidation was not enhanced in the liver of DHA-rich oil-fed C57BL/6 mice. A–C: The mRNA expression levels of FA oxidation-related genes (Acs, Cpt1a, and Aox) in the liver were determined by real-time PCR. D, E: Production of CO2 and ASM in the liver was determined using [14C]palmitic acid. Control values were set at 100% and the relative values are represented as fold induction relative to that of control. The values are means ± SEM of six tests.

      DHA-rich oil attenuated postprandial TG levels by reducing TG secretion from intestinal epithelial cells in mice

      To investigate whether DHA-rich oil decreases postprandial TG levels in mice, we measured plasma TG levels every 30 min to 240 min after oral administration of olive oil. Plasma TG levels were significantly lower in DHA-rich oil-fed mice than those in control mice from 120 to 240 min after administration (Fig. 6A). It was also confirmed that postprandial triglyceridemic response, determined based on the area under the curve (AUC), was lowered to 66 and 45% in 1.9 and 3.7% DHA-rich oil-fed mice, respectively (Fig. 6B). In addition, plasma apoB48 was also reduced at 120 min in 3.7% DHA-rich oil-fed mice (Fig. 6C). To clarify whether DHA-rich oil altered postprandial TG secretion from intestinal epithelial cells, we measured plasma TG levels after oral administration of olive oil in the presence of tyloxapol, an inhibitor of TG clearance. Plasma TG levels were significantly decreased after 150 min and AUC was reduced to 66% in 3.7% DHA-rich oil-fed mice compared with control mice (Fig. 6D, E). Furthermore, TG accumulation in intestinal epithelial cells was lower in DHA-rich oil-fed mice than in control mice and there was no difference in the weight of feces and fecal TG levels between control and DHA-rich oil-fed mice (Fig. 6F–H). In contrast, EPA did not affect postprandial lipid metabolism compared with DHA (supplementary Fig. III). These results suggest that DHA attenuates postprandial hypertriglyceridemia by decreasing TG secretion from intestinal epithelial cells.
      Figure thumbnail gr6
      Fig. 6Postprandial hyperlipidemia was attenuated by decreasing TG secretion from intestinal epithelial cells of DHA-rich oil-fed C57BL/6 mice. A, B: Plasma TG levels every 30 to 240 min and plasma apoB48 levels at 120 min after oral administration of olive oil were measured in control (Cont) and DHA-rich oil-fed C57BL/6 mice. Plasma TG level was measured by enzymatic colorimetric assay. C: Plasma apoB48 protein levels at 120 min were visualized by Western blotting and band density was determined using National Institutes of Health Image J software. D, E: Postprandial TG secretion in control and DHA-rich oil-fed mice that had been administered tyloxapol, an inhibitor of TG clearance, was examined. AUC is shown as relative values and is represented as fold induction relative to that of the control, which was set at 100%. TG content in intestinal epithelial cells (F), the weight of feces (G), and fecal TG levels (H) in control and DHA-rich oil-fed C57BL/6 mice were determined as described in the Materials and Methods section. The values are means ± SEM of 5–10 tests. *P < 0.05 and **P < 0.01 compared with each control.

      Effects of DHA on postprandial lipid metabolism were mediated by the activation of intestinal PPARα

      To clarify the involvement of PPARα in the effects of DHA on postprandial lipid metabolism, we examined the effects of DHA in PPARα−/− mice. The baseline characteristics of PPARα−/− mice compared with control mice are shown in supplementary Table I. The mRNA expression levels of genes involved in FA oxidation (Acs, Cpt1a, and Aox), and the production of CO2 and ASMs did not change significantly in intestinal epithelial cells of DHA-rich oil-fed PPARα−/− mice or bezafibrate-fed PPARα−/− mice (Fig. 7A–E, supplementary Fig. IVA–C). Moreover, there was no difference in intestinal TG levels between DHA-rich oil-fed PPARα−/− mice and control mice (Fig. 7F). Finally, the effects of DHA-rich oil on plasma TG and apoB levels after olive oil administration were abolished in PPARα−/− mice without and with tyloxapol, similar to the results of bezafibrate (Fig. 7G–I, supplementary Fig. IVD–F), suggesting that lipid secretion from intestinal epithelial cells is related to PPARα activity. These findings suggest that the activation of intestinal PPARα is a key factor for attenuating postprandial hyperlipidemia by decreasing TG secretion from intestinal epithelial cells.
      Figure thumbnail gr7
      Fig. 7Effects of DHA-rich oil on intestinal lipid metabolism and postprandial hyperlipidemia were abolished in PPARα−/− mice. A–C: mRNA expression levels of FA oxidation-related genes (Acs, Cpt1a, and Aox) in intestinal epithelial cells were determined using real-time PCR. D, E: CO2 and ASM production in intestinal epithelial cells were determined using [14C]palmitic acid. Control values were set at 100% and the relative values are represented as fold induction relative to that of control. F: TG content in intestinal epithelial cells was measured. G: Plasma TG levels, every 30 to 240 min after oral administration of olive oil, were measured in control and DHA-rich oil-fed PPARα−/− mice. Postprandial TG secretion every 30 to 240 min (H) and apoB48 secretion at 120 min (I) after oral administration of olive oil in control and DHA-rich oil-fed mice which had been administered tyloxapol, an inhibitor of TG clearance, were examined. Values are means ± SEM of five tests.

      DISCUSSION

      Activation of PPARα is well-known to decrease plasma TG levels through FA oxidation in the liver and skeletal muscle (
      • Kersten S.
      • Desvergne B.
      • Wahli W.
      Roles of PPARs in health and disease.
      ,
      • Hashimoto T.
      • Cook W.
      • Qi C.
      • Yeldandi A.
      • Reddy J.
      • Rao M.
      Defect in peroxisome proliferator-activated receptor alpha inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting.
      ,
      • Minnich A.
      • Tian N.
      • Byan L.
      • Bilder G.
      A potent PPAR agonist stimulates mitochondrial fatty acid-oxidation in liver and skeletal muscle.
      ). Although the role of PPARα expressed in intestinal epithelial cells remained obscure (
      • Bünger M.
      • Van Den Bosch H.M.
      • Van Der Meijde J.
      • Kersten S.
      • Hooiveld G.
      • Müller M.
      Genome-wide analysis of PPARalpha activation in murine small intestine.
      ,
      • Escher P.
      • Braissant O.
      • Basu-Modak S.
      • Michalik L.
      • Wahli W.
      • Desvergne B.
      Rat PPARs: quantitative analysis in adult rat tissues and regulation in fasting and refeeding.
      ), we and others have recently demonstrated that PPARα agonists improve postprandial hyperlipidemia through increasing FA oxidation in intestinal epithelial cells (
      • Kimura R.
      • Takahashi N.
      • Murota K.
      • Yamada Y.
      • Niiya S.
      • Kanzaki N.
      • Murakami Y.
      • Moriyama T.
      • Goto T.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-α (PPARα) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes.
      ,
      • Uchida A.
      • Slipchenko M.N.
      • Cheng J.X.
      • Buhman K.K.
      Fenofibrate, a peroxisome proliferator-activated receptor α agonist, alters triglyceride metabolism in enterocytes of mice.
      ). It is suggested that PPARα activation reduces TG secretion from intestinal epithelial cells, which attenuates postprandial hyperlipidemia (
      • Kimura R.
      • Takahashi N.
      • Murota K.
      • Yamada Y.
      • Niiya S.
      • Kanzaki N.
      • Murakami Y.
      • Moriyama T.
      • Goto T.
      • Kawada T.
      Activation of peroxisome proliferator-activated receptor-α (PPARα) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes.
      ,
      • Uchida A.
      • Slipchenko M.N.
      • Cheng J.X.
      • Buhman K.K.
      Fenofibrate, a peroxisome proliferator-activated receptor α agonist, alters triglyceride metabolism in enterocytes of mice.
      ) (supplementary Fig. IV). To clarify the contribution of intestinal PPARα activation to postprandial systemic lipid metabolism, further investigation is necessary, including studies involving intestinal epithelial cell-specific PPARα knockout mice. However, these findings indicate that intestinal PPARα activation plays a critical role in positive regulation of postprandial systemic lipid metabolism.
      Although it has been shown that PPARα activation in intestinal epithelial cells reduces postprandial hyperlipidemia, it was unknown whether postprandial hyperlipidemia is also improved by dietary lipids, which generally show lower PPARα activation than synthesized PPARα agonists (
      • Kim Y.I.
      • Hirai S.
      • Goto T.
      • Ohyane C.
      • Takahashi H.
      • Tsugane T.
      • Konishi C.
      • Fujii T.
      • Inai S.
      • Iijima Y.
      • et al.
      Potent PPARα activator derived from tomato juice, 13-oxo-9,11-octadecadienoic acid, decreases plasma and hepatic triglyceride in obese diabetic mice.
      ,
      • Shen P.
      • Liu M.H.
      • Ng T.Y.
      • Chan Y.H.
      • Yong E.L.
      Differential effects of isoflavones, from Astragalus membranaceus and Pueraria thomsonii, on the activation of PPARalpha, PPARgamma, and adipocyte differentiation in vitro.
      ). Previous studies have indicated that DHA increases mRNA expression levels of FA oxidation-related genes in intestinal epithelial cells (
      • de Vogel-van den Bosch H.M.
      • Bünger M.
      • de Groot P.J.
      • Bosch-Vermeulen H.
      • Hooiveld G.J.
      • Müller M.
      PPARalpha-mediated effects of dietary lipids on intestinal barrier gene expression.
      ,
      • Mori T.
      • Kondo H.
      • Hase T.
      • Tokimitsu I.
      • Murase T.
      Dietary fish oil upregulates intestinal lipid metabolism and reduces body weight gain in C57BL/6J mice.
      ) and that PUFAs including DHA enhance FA oxidation in hepatocytes (
      • Shearer G.C.
      • Savinova O.V.
      • Harris W.S.
      Fish oil – How does it reduce plasma triglycerides?.
      ). The present study showed that DHA enhanced FA oxidation and decreased TG secretion in Caco-2 cells and intestinal epithelial cells (Fig. 2, Fig. 3, Fig. 4, 6), resulting in reduction of postprandial hyperlipidemia via PPARα activation in mice (Figs. 6, 7). However, surprisingly, no induction of the genes involved in FA oxidation was observed in the liver of DHA rich oil-fed mice under our experimental conditions (Fig. 5). Our findings presented here strongly indicate that effects of DHA in attenuating postprandial hyperlipidemia are attributed to the decrease of TG secretion from intestinal epithelial cells. During early stages after a meal, most TG secretion into circulation is thought to be derived from dietary fat absorbed in intestinal epithelial cells because they are directly exposed to dietary fat, while insulin prevents hepatic VLDL secretion during the postprandial state (
      • Lewis G.F.
      • Uffelman K.D.
      • Szeto L.W.
      • Steiner G.
      Effects of acute hyperinsulinemia on VLDL triglyceride and VLDL apoB production in normal weight and obese individuals.
      ,
      • Baker P.W.
      • Gibbons G.F.
      Effect of dietary fish oil on the sensitivity of hepatic lipid metabolism to regulation by insulin.
      ). In DHA rich oil-fed mice, plasma TG levels were decreased after olive oil administration with tyloxapol, which inhibits plasma lipoprotein lipase, suggesting that TG secretion from intestinal epithelial cells was reduced (Fig. 6D). This was supported by the results that DHA reduced TG and apoB secretion in Caco-2 cells, as shown in Fig. 3. Moreover, we observed that TG accumulation in intestinal epithelial cells was generally decreased (Fig. 6F) and the level in the weight of feces and fecal TG did not change in DHA-rich oil-fed mice (Fig. 6G, H). These findings suggest that DHA is a potent factor to reduce TG secretion from intestinal epithelial cells via FA oxidation by PPARα activation, resulting in attenuating postprandial hyperlipidemia.
      In this study, mRNA expression levels of intestinal FA oxidation-related genes in DHA-rich oil-fed PPARα−/− mice were increased, although the increases were not significant (Fig. 7A, C). Previous reports have indicated that PPARδ compensates for the lack of PPARα in the skeletal muscles of PPARα−/− mice (
      • Muoio D.M.
      • MacLean P.S.
      • Lang D.B.
      • Li S.
      • Houmard J.A.
      • Way J.M.
      • Winegar D.A.
      • Corton J.C.
      • Dohm G.L.
      • Kraus W.E.
      Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) alpha knock-out mice. Evidence for compensatory regulation by PPAR delta.
      ) and that PPARδ activates FA oxidation (
      • Kleiner S.
      • Nguyen-Tran V.
      • Baré O.
      • Huang X.
      • Spiegelman B.
      • Wu Z.
      PPAR{delta} agonism activates fatty acid oxidation via PGC-1{alpha} but does not increase mitochondrial gene expression and function.
      ). DHA and bezafibrate did not activate PPARδ in our luciferase assays (Fig. 1E, supplementary Fig. I). However, the concentration of DHA exposed to intestinal epithelial cells may have been much higher than that used in Caco-2 cells. Therefore, the increase in intestinal FA oxidation-related genes in Fig. 7A and C may be related to the PPARδ effect.
      The present study showed higher mRNA expression levels of Cd36 (Fig. 4), which is involved in FA transport in intestinal epithelial cells of DHA-rich oil-fed mice. Cd36 is thought to be involved in regulating chylomicron production (
      • Drover V.A.
      • Ajmal M.
      • Nassir F.
      • Davidson N.O.
      • Nauli A.M.
      • Sahoo D.
      • Tso P.
      • Abumrad N.A.
      CD36 deficiency impairs intestinal lipid secretion and clearance of chylomicrons from the blood.
      ,
      • Tran T.T.
      • Poirier H.
      • Clément L.
      • Nassir F.
      • Pelsers M.M.
      • Petit V.
      • Degrace P.
      • Monnot M.C.
      • Glatz J.F.
      • Abumrad N.A.
      • et al.
      Luminal lipid regulates CD36 levels and downstream signaling to stimulate chylomicron synthesis.
      ). Interestingly, Cd36 knockout mice showed both fasting and postprandial hyperlipidemia and have been used as a model of postprandial hyperlipidemia (
      • Masuda D.
      • Hirano K.
      • Oku H.
      • Sandoval J.C.
      • Kawase R.
      • Yuasa-Kawase M.
      • Yamashita Y.
      • Takada M.
      • Tsubakio-Yamamoto K.
      • Tochino Y.
      • et al.
      Chylomicron remnants are increased in the postprandial state in CD36 deficiency.
      ). A recent study showed that Cd36 critically regulates FA oxidation in skeletal muscle (
      • McFarlan J.T.
      • Yoshida Y.
      • Jain S.S.
      • Han X.X.
      • Snook L.A.
      • Lally J.
      • Smith B.K.
      • Glatz J.F.
      • Luiken J.J.
      • Sayer R.A.
      • et al.
      In vivo, fatty acid translocase (CD36) critically regulates skeletal muscle fuel selection, exercise performance, and training-induced adaptation of fatty acid oxidation.
      ). Additionally, Cd36 is one of PPARα target genes (
      • Rakhshandehroo M.
      • Knoch B.
      • Müller M.
      • Kersten S.
      Peroxisome proliferator-activated receptor alpha target genes.
      ). Therefore, an increase of Cd36 may contribute to reduction of postprandial hyperlipidemia via intestinal FA oxidation in DHA-rich oil-fed mice.
      In conclusion, we found that DHA directly reduced TG secretion from intestinal epithelial cells by activation of PPARα-induced FA oxidation, resulting in improving postprandial hyperlipidemia. The present work suggests that a dietary lipid such as DHA, which activates PPARα, is a promising factor to attenuate postprandial hyperlipidemia via intestinal FA oxidation.

      Acknowledgments

      The authors would like to thank Y. Tada, M. Hirata, and Y. Mine for their technical support.

      Supplementary Material

      REFERENCES

        • Ogden C.L.
        • Yanovski S.Z.
        • Carroll M.D.
        • Flegal K.M.
        The epidemiology of obesity.
        Gastroenterology. 2007; 132: 2087-2102
        • Bansal S.
        • Buring J.E.
        • Rifai N.
        • Mora S.
        • Sacks F.M.
        • Ridker P.M.
        Fasting compared with nonfasting triglycerides and risk of cardiovascular events in women.
        JAMA. 2007; 298: 309-316
        • Freiberg J.J.
        • Tybjaerg-Hansen A.
        • Jensen J.S.
        • Nordestgaard B.G.
        Nonfasting triglycerides and risk of ischemic stroke in the general population.
        JAMA. 2008; 300: 2142-2152
        • Iso H.
        • Naito Y.
        • Sato S.
        • Kitamura A.
        • Okamura T.
        • Sankai T.
        • Shimamoto T.
        • Iida M.
        • Komachi Y.
        Serum triglycerides and risk of coronary heart disease among Japanese men and women.
        Am. J. Epidemiol. 2001; 153: 490-499
        • Boquist S.
        • Ruotolo G.
        • Tang R.
        • Björkegren J.
        • Bond M.G.
        • de Faire U.
        • Karpe F.
        • Hamsten A.
        Alimentary lipemia, postprandial triglyceride-rich lipoproteins, and common carotid intima-media thickness in healthy, middle-aged men.
        Circulation. 1999; 100: 723-728
        • Patsch J.R.
        • Miesenböck G.
        • Hopferwieser T.
        • Mühlberger V.
        • Knapp E.
        • Dunn J.K.
        • Gotto Jr, A.M.
        • Patsch W.
        Relation of triglyceride metabolism and coronary artery disease. Studies in the postprandial state.
        Arterioscler. Thromb. 1992; 12: 1336-1345
        • Björkegren J.
        • Boquist S.
        • Samnegârd A.
        • Lundman P.
        • Tornvall P.
        • Ericsson C.G.
        • Hamsten A.
        Accumulation of apolipoprotein C–I-rich and cholesterol-rich VLDL remnants during exaggerated postprandial triglyceridemia in normolipidemic patients with coronary artery disease.
        Circulation. 2000; 101: 227-230
        • Bünger M.
        • Van Den Bosch H.M.
        • Van Der Meijde J.
        • Kersten S.
        • Hooiveld G.
        • Müller M.
        Genome-wide analysis of PPARalpha activation in murine small intestine.
        Physiol. Genomics. 2007; 30: 192-204
        • Kersten S.
        • Desvergne B.
        • Wahli W.
        Roles of PPARs in health and disease.
        Nature. 2000; 405: 421-424
        • Hashimoto T.
        • Cook W.
        • Qi C.
        • Yeldandi A.
        • Reddy J.
        • Rao M.
        Defect in peroxisome proliferator-activated receptor alpha inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting.
        J. Biol. Chem. 2000; 275: 28918-28928
        • Minnich A.
        • Tian N.
        • Byan L.
        • Bilder G.
        A potent PPAR agonist stimulates mitochondrial fatty acid-oxidation in liver and skeletal muscle.
        Am. J. Physiol. Endocrinol. Metab. 2001; 280: E270-E279
        • Schoonjans K.
        • Staels B.
        • Auwerx J.
        Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression.
        J. Lipid Res. 1996; 37: 907-925
        • Akiyama T.E.
        • Nicol C.J.
        • Fievet C.
        • Staels B.
        • Ward J.M.
        • Auwerx J.
        • Lee S.S.
        • Gonzalez F.J.
        • Peters J.M.
        Peroxisome proliferator-activated receptor-alpha regulates lipid homeostasis, but is not associated with obesity: studies with congenic mouse lines.
        J. Biol. Chem. 2001; 276: 39088-39093
        • Lindén D.
        • Alsterholm M.
        • Wennbo H.
        • Oscarsson J.
        PPARalpha deficiency increases secretion and serum levels of apolipoprotein B-containing lipoproteins.
        J. Lipid Res. 2001; 42: 1831-1840
        • Kimura R.
        • Takahashi N.
        • Murota K.
        • Yamada Y.
        • Niiya S.
        • Kanzaki N.
        • Murakami Y.
        • Moriyama T.
        • Goto T.
        • Kawada T.
        Activation of peroxisome proliferator-activated receptor-α (PPARα) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes.
        Biochem. Biophys. Res. Commun. 2011; 410: 1-6
        • Uchida A.
        • Slipchenko M.N.
        • Cheng J.X.
        • Buhman K.K.
        Fenofibrate, a peroxisome proliferator-activated receptor α agonist, alters triglyceride metabolism in enterocytes of mice.
        Biochim. Biophys. Acta. 2011; 1811: 170-176
        • Wong S.H.
        • Fisher E.A.
        • Marsh J.B.
        Effects of eicosapentaenoic and docosahexaenoic acids on apoprotein B mRNA and secretion of very low density lipoprotein in HepG2 cells.
        Arteriosclerosis. 1989; 9: 836-841
        • Nestel P.J.
        • Connor W.E.
        • Reardon M.F.
        • Connor S.
        • Wong S.
        • Boston R.
        Suppression by diets rich in fish oil of very low density lipoprotein production in man.
        J. Clin. Invest. 1984; 74: 82-89
        • Park Y.
        • Harris W.S.
        Omega-3 fatty acid supplementation accelerates chylomicron triglyceride clearance.
        J. Lipid Res. 2003; 44: 455-463
        • van Schothorst E.M.
        • Flachs P.
        • Franssen-van Hal N.L.
        • Kuda O.
        • Bunschoten A.
        • Molthoff J.
        • Vink C.
        • Hooiveld G.J.
        • Kopecky J.
        • Keijer J.
        Induction of lipid oxidation by polyunsaturated fatty acids of marine origin in small intestine of mice fed a high-fat diet.
        BMC Genomics. 2009; 10: 110
        • Goto T.
        • Takahashi N.
        • Kato S.
        • Egawa K.
        • Ebisu S.
        • Moriyama T.
        • Fushiki T.
        • Kawada T.
        Phytol directly activates peroxisome proliferator-activated receptor alpha (PPAR alpha) and regulates gene expression involved in lipid metabolism in PPAR alpha-expressing HepG2 hepatocytes.
        Biochem. Biophys. Res. Commun. 2005; 337: 440-445
        • Kuroyanagi K.
        • Kang M.S.
        • Goto T.
        • Hirai S.
        • Ohyama K.
        • Kusudo T.
        • Yu R.
        • Yano M.
        • Sasaki T.
        • Takahashi N.
        • et al.
        Citrus auraptene acts as an agonist for PPARs and enhances adiponectin production and MCP-1 reduction in 3T3–L1 adipocytes.
        Biochem. Biophys. Res. Commun. 2008; 366: 219-225
        • Takahashi N.
        • Senda M.
        • Lin S.
        • Goto T.
        • Yano M.
        • Sasaki T.
        • Murakami S.
        • Kawada T.
        Auraptene regulates gene expression involved in lipid metabolism through PPARα activation in diabetic obese mice.
        Mol. Nutr. Food Res. 2011; 55: 1791-1797
        • Wu M.
        • Neilson A.
        • Swift A.L.
        • Moran R.
        • Tamagnine J.
        • Parslow D.
        • Armistead S.
        • Lemire K.
        • Orrell J.
        • Teich J.
        • et al.
        Multiparameter metabolic analysis reveals a close link between attenuated mitochondrial bioenergetic function and enhanced glycolysis dependency in human tumor cells.
        Am. J. Physiol. Cell Physiol. 2007; 292: C125-C136
        • Goto T.
        • Lee J.Y.
        • Teraminami A.
        • Kim Y.I.
        • Hirai S.
        • Uemura T.
        • Inoue H.
        • Takahashi N.
        • Kawada T.
        Activation of peroxisome proliferator-activated receptor-alpha stimulates both differentiation and fatty acid oxidation in adipocytes.
        J. Lipid Res. 2011; 52: 873-884
        • Hernández Vallejo S.J.
        • Alqub M.
        • Luquet S.
        • Cruciani-Guglielmacci C.
        • Delerive P.
        • Lobaccaro J.M.
        • Kalopissis A.D.
        • Chambaz J.
        • Rousset M.
        • Lacorte J.M.
        Short-term adaptation of postprandial lipoprotein secretion and intestinal gene expression to a high-fat diet.
        Am. J. Physiol. Gastrointest. Liver Physiol. 2009; 296: G782-G792
        • Nakatani T.
        • Kim H.J.
        • Kaburagi Y.
        • Yasuda K.
        • Ezaki O.
        A low fish oil inhibits SREBP-1 proteolytic cascade, while a high-fish-oil feeding decreases SREBP-1 mRNA in mice liver: relationship to anti-obesity.
        J. Lipid Res. 2003; 44: 369-379
        • Lin X.
        • Yue P.
        • Chen Z.
        • Schonfeld G.
        Hepatic triglyceride contents are genetically determined in mice: results of a strain survey.
        Am. J. Physiol. Gastrointest. Liver Physiol. 2005; 288: G1179-G1189
        • Eder K.
        • Reichlmayr-Lais A.M.
        • Kirchgessner M.
        Studies on the extraction of phospholipids from erythrocyte membranes in the rat.
        Clin. Chim. Acta. 1993; 219: 93-104
        • Perera M.A.
        • Choi S.Y.
        • Wurtele E.S.
        • Nikolau B.J.
        Quantitative analysis of short-chain acyl-coenzyme As in plant tissues by LC-MS-MS electrospray ionization method.
        J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2009; 877: 482-488
        • Folch J.
        • Lees M.
        • Sloane Stanley G.H.
        A simple method for the isolation and purification of total lipids from animal tissues.
        J. Biol. Chem. 1957; 226: 497-509
        • Fu J.
        • Gaetani S.
        • Oveisi F.
        • Lo Verme J.
        • Serrano A.
        • Rodríguez De Fonseca F.
        • Rosengarth A.
        • Luecke H.
        • Di Giacomo B.
        • Tarzia G.
        • et al.
        Oleylethanolamide regulates feeding and body weight through activation of the nuclear receptor PPAR-alpha.
        Nature. 2003; 425: 90-93
        • Escher P.
        • Braissant O.
        • Basu-Modak S.
        • Michalik L.
        • Wahli W.
        • Desvergne B.
        Rat PPARs: quantitative analysis in adult rat tissues and regulation in fasting and refeeding.
        Endocrinology. 2001; 142: 4195-4202
        • Kim Y.I.
        • Hirai S.
        • Goto T.
        • Ohyane C.
        • Takahashi H.
        • Tsugane T.
        • Konishi C.
        • Fujii T.
        • Inai S.
        • Iijima Y.
        • et al.
        Potent PPARα activator derived from tomato juice, 13-oxo-9,11-octadecadienoic acid, decreases plasma and hepatic triglyceride in obese diabetic mice.
        PLoS ONE. 2012; 7: e31317
        • Shen P.
        • Liu M.H.
        • Ng T.Y.
        • Chan Y.H.
        • Yong E.L.
        Differential effects of isoflavones, from Astragalus membranaceus and Pueraria thomsonii, on the activation of PPARalpha, PPARgamma, and adipocyte differentiation in vitro.
        J. Nutr. 2006; 136: 899-905
        • de Vogel-van den Bosch H.M.
        • Bünger M.
        • de Groot P.J.
        • Bosch-Vermeulen H.
        • Hooiveld G.J.
        • Müller M.
        PPARalpha-mediated effects of dietary lipids on intestinal barrier gene expression.
        BMC Genomics. 2008; 9: 231
        • Mori T.
        • Kondo H.
        • Hase T.
        • Tokimitsu I.
        • Murase T.
        Dietary fish oil upregulates intestinal lipid metabolism and reduces body weight gain in C57BL/6J mice.
        J. Nutr. 2007; 137: 2629-2634
        • Shearer G.C.
        • Savinova O.V.
        • Harris W.S.
        Fish oil – How does it reduce plasma triglycerides?.
        Biochim. Biophys. Acta. 2012; 1821: 843-851
        • Lewis G.F.
        • Uffelman K.D.
        • Szeto L.W.
        • Steiner G.
        Effects of acute hyperinsulinemia on VLDL triglyceride and VLDL apoB production in normal weight and obese individuals.
        Diabetes. 1993; 42: 833-842
        • Baker P.W.
        • Gibbons G.F.
        Effect of dietary fish oil on the sensitivity of hepatic lipid metabolism to regulation by insulin.
        J. Lipid Res. 2000; 41: 719-726
        • Muoio D.M.
        • MacLean P.S.
        • Lang D.B.
        • Li S.
        • Houmard J.A.
        • Way J.M.
        • Winegar D.A.
        • Corton J.C.
        • Dohm G.L.
        • Kraus W.E.
        Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) alpha knock-out mice. Evidence for compensatory regulation by PPAR delta.
        J. Biol. Chem. 2002; 277: 26089-26097
        • Kleiner S.
        • Nguyen-Tran V.
        • Baré O.
        • Huang X.
        • Spiegelman B.
        • Wu Z.
        PPAR{delta} agonism activates fatty acid oxidation via PGC-1{alpha} but does not increase mitochondrial gene expression and function.
        J. Biol. Chem. 2009; 284: 18624-18633
        • Drover V.A.
        • Ajmal M.
        • Nassir F.
        • Davidson N.O.
        • Nauli A.M.
        • Sahoo D.
        • Tso P.
        • Abumrad N.A.
        CD36 deficiency impairs intestinal lipid secretion and clearance of chylomicrons from the blood.
        J. Clin. Invest. 2005; 115: 1290-1297
        • Tran T.T.
        • Poirier H.
        • Clément L.
        • Nassir F.
        • Pelsers M.M.
        • Petit V.
        • Degrace P.
        • Monnot M.C.
        • Glatz J.F.
        • Abumrad N.A.
        • et al.
        Luminal lipid regulates CD36 levels and downstream signaling to stimulate chylomicron synthesis.
        J. Biol. Chem. 2011; 286: 25201-25210
        • Masuda D.
        • Hirano K.
        • Oku H.
        • Sandoval J.C.
        • Kawase R.
        • Yuasa-Kawase M.
        • Yamashita Y.
        • Takada M.
        • Tsubakio-Yamamoto K.
        • Tochino Y.
        • et al.
        Chylomicron remnants are increased in the postprandial state in CD36 deficiency.
        J. Lipid Res. 2009; 50: 999-1011
        • McFarlan J.T.
        • Yoshida Y.
        • Jain S.S.
        • Han X.X.
        • Snook L.A.
        • Lally J.
        • Smith B.K.
        • Glatz J.F.
        • Luiken J.J.
        • Sayer R.A.
        • et al.
        In vivo, fatty acid translocase (CD36) critically regulates skeletal muscle fuel selection, exercise performance, and training-induced adaptation of fatty acid oxidation.
        J. Biol. Chem. 2012; 287: 23502-23516
        • Rakhshandehroo M.
        • Knoch B.
        • Müller M.
        • Kersten S.
        Peroxisome proliferator-activated receptor alpha target genes.
        PPAR Res. 2010; 2010: 612089